Transcript

gpr17-201

ID
ZDB-TSCRIPT-100915-549
Name
gpr17-201
Previous Names
  • gpr17-001
  • ch73-194h10.4-001
  • si:ch73-194h10.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043780 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043780|OTTDARG00000031452|ZDB-GENE-100922-133 gpr17|OTTDARP00000034698 CH73-194H10.4-001 LG_ FP016006.9 Danio rerio protein_coding NOVEL, 1020 bp
ATGGAGTCCTCCTTGACAGAACTTCCCACCTTGCTGCCCA
ACCAGTCCATGGACAGCTGCCCACCGGTGGAAAACACAGC
AGAGAACATGATGTTTGGAATCTACTACATCATAGTTTTC
CTCCTGGCACTAAGCGGCAATAGCCTTGCCCTGTGGATCT
TTGCCCGCCAGAGAAACAACTCCTCACCAGCTAACGTCTT
CCTGCTCCACCTTGCTGTTGCCGACTTGTTTTATGTCTTT
ATTTTACCCCTTAGGGCCACTTATCATTTAACTGGAGGTC
ATTGGCCATTTGGTGAAATCCCTTGTCGTCTGGCAGGCTT
TTTCTTCTATGTCAACATGTATGCCAGTTTGTACTTTCTG
GCCTGTGTTGCAGGTGACAGATACCTTGCTGTGGTGCATG
CTGTACGCTCCCTCAAGGTCAGACGTCCTCATTACGCTCA
CATAGCCAGTTTTGCACTTTGGATTTTGGTGATTGTGTCT
ATGGCACCCCTGCTGATCACCAAGCAGACTGTAGAAGTCA
ATGGCTCAACCGTATGTTTGCAACTGTACAGAGAAAAGGC
CTCGTGGCGTGCACTAGTCTCTCTTGTTGTAGCTTTCACA
CCACCCTTCATTGCTACACTTTCCTGCTATCTGCTGATAG
TTAACAGTCTGCGCAAGGGTTCAAGGCTGGAGCCAGCCCT
GAAACTCCGGGCTCTCCGTACCATCGGTCTGGTCATGTTT
ATCTATGTAGTGTGCTTTTTGCCTTATCACTTAAGTCGTG
CAACTTTTATCCTGGGCTACGGACACCCAGACCTGTCCTG
CCAAATCAAAAGAGGACTAGCTCTGGCTAACCGTCTTACC
TCCTCGCTGACCTGCCTGAATGGGGGTCTGGATCCTCTGG
TTTACCTGTTTGCAGCAGAGAAGTTCAGGGGAAGCGTTCG
CAGGATTTTTTGCCGAGACAAGTCAGGAGGGTCTGGCGCT
ACTAGCGGGGAGCTAAAAGGGACACATGAGAGTTCTCTGA
GTGCAAAGTCTGAGTTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations