Community Action Needed: Please respond to the NIH RFI
Transcript

si:ch73-215d9.1-201

ID
ZDB-TSCRIPT-100915-432
Name
si:ch73-215d9.1-201
Previous Names
  • ch73-215d9.1-001
  • si:ch73-215d9.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047070 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047070|OTTDARG00000033470|ZDB-GENE-100922-40 si:ch73-215d9.1|OTTDARP00000037035 CH73-215D9.1-001 LG_none FQ323103.4,CU468287.6 Danio rerio protein_coding PUTATIVE, 3412 bp
GTCTTTATCTGCTGACACTCCCTCCCGCAGACAAACACAC
ACACACCTCAGCATCTTTCCAGCTATATCAGAGCTTTCAT
TACAAGATCATTGCCGCAATATCAGCTCTTCACCACAGCT
TTAGTTTACTCCATCAGCTTGTGTCCAGCACGAATTCGCC
ATGGAGTAGCAGCACGGAAGCAGATCCTCGATATCATGGA
AACAGATGCTTGAATAAGAGCGTCACATCCCTCTGGGTTT
GAAGAAGTAATGTCTGTTAGAAACCATCGCTGTGAAAAGG
CGGCAGTGGCATCATGAACTTCTTACCAGTTCTTTCACTT
TTGATACTCTTATGTATCAGAGTATCAGGACAGTGCTGGC
AGGCCGCAACCTACTCTGAAAGCGTGGTGTCTCCGGAGCT
GAGGAGCAGCAGTATTTTACGTGTCCCGGATGTGTCGTCC
CTGGCTCAGTGTGCCGGGGCCTGCTGTGATCTCCCGGGCT
GTGACCTGGCCTGGTTTTTTGAGCACCGATGCTATGTGCT
CAGTTGTCAGCACACAGAAAACTGCCAGCCGAAGAAGAGA
CCTGGTACAGACTCTTACCTGGCCTTCCTGCAACGTGGGC
CCCCACAAACACTTGTCCTGCAGTCCCTGGTTCGAGGAGA
GTCTTTCCCAAACCATTGGCAGCCTCTGGCCAGACACCGG
GGATCCGAGGATCCCATGAAGGATCTCGCTCTGCTTGAAG
GGATTCAGGATTCGGACAACCCTGAGCCTGAGTATGCAGA
GAGTTTTCGAAGTTTGGAAGACAAAAGAGCTGAAGACATA
GACCTAAAAGCGGTAGAGCAAGAAGAGCAAACTGGGCTTT
ATGATTGGCCACCTGTTCAAAGAAAAGAGGAATTCAACCA
ATCAGAGACGGAGAGAGGCAGTAAAAGATTGACAACTGTT
CAGGGCCCTGTTGAAAGTAGCACCATTACCCCAAGTCATC
TTTCAGAAGAGAGAAATGAAAGCAGATCAACCATTATTGA
AGCAGAATCTAATGTTACGGTACCATCAACCACTGTATTT
GACATTAAGGTTGAAGAAGAGCCACAGAACACATCGTCTG
CAACTACTGCACCTAAAGTCGTGGAAGACCTCAGTACAGA
GACCGCAAACTTTAGTGCAGTCAACGGTTCATTCATCACT
CCAGCCAACACTGAAGCTACACCGCAGATGACTTCAGAAC
AGCCAGTAAGAGCTCTGACTGTGTCCATTGAAGGCCCTGT
TGAAGCCATGCTGCCCCAAAACACTGTTAAACTAACAGCT
TTAGTTAGTCCAGATGATACTGCCGAATCTCCTTACACAT
ATGAGTGGACTTTTGTGATCTCACCAGAAGGACAACGTAG
GGTGATGGAGGGGCAGCACAACAAATCTGTCATACTTTCT
GAACTGTCAGAGGGTGTTTACGCAGTCAGAGTGATTGTGA
AAGCACATCAAGCATATGGAGAAGGTTCTGTGGACTTGAC
CGTACACCCTGCAGAGAAAATAAACAAGCCTCCTAAAGCA
GTCGTTCTTCCCAAGAGCCAAGATGTGCTGTTCAAAAAAG
ATTCTGTCTTAATCATTAACGGAAGTGAGAGTATGGATGA
TGCAGGGATTGTCAGTTATCTGTGGAAAAAGGTGGACGGC
CCGTTTTGGACACCTGAAGGTCCTGTTAACAAACCTGTAC
TGCAGCTGAAAAATCTTTTACCTGGAGAATATACCTTCGA
GCTGACAGTGTCTGATTCTGAGGGGCTGAGCGACTCCAGC
ACTGCCACCTTGAGGGTCAGCATCCCAAAAGATGAGCCTC
CTCTGGCCAGAGCGGGCACAGACCGGGTCATTACCCTGCC
TCTCAACCACCTCACCCTGTGGGGAAACCAAAGCACAGAT
GACCAGGCCATTACAAGCTACCTCTGGACACTCCATCCCA
GCAGCCCGACCCGAAAGGTCACCATGCAGGATGTGAGATC
AGCATTTCTGCTAGTCTCTGATCTAGAGGAGGGTCAGTAC
ACGTTTCAGCTCACAGTCACTGACTCAAGAGGTCAACAGG
ATTCAGACACCATCTCTGTCACTGTGCTGCCTGCAAACAG
AGCACCAGTGGCTGTAACAGGACCAGACATACAGCTACTC
CTGCCGGTCAACAGCATCACACTGAATGGCAGCGGCAGCA
CTGATGATCAGGCCATCAGCAGATACCAGTGGGACGTGAT
GAGTGGCCCTCCAGGCTTGAAGATGAAAGATGCCAATAAA
GCGGTTGCCATCGCGACAGGCCTGAGATCTGGGATTTACA
AGTTGAAGTTGACTGTGGTGGATGAGCAGGGAGAAACAGA
CAGTGCAGTCCTGAGCATCACAGTTAAAGAAGCTAAAAGC
CTGCCACTGGTGGCTCATGCCAGCGGCAGCCATACACTCA
CTTTGCCCAACAACTCTCTGGTGCTCAGAGGTTCAGTGTC
CAACAGCGGACCAGCAAACGTGTCCTTTCTGTGGGTTAGA
GATGAACAGAGCCCTGCTGCGGGGGATGTGTTGTATGGTT
CAGATCACGAGGCCTCGCTTTACCTTGCCAACCTGGTAGA
AGGAACATACCTGTTCCAGCTGCGGGTCACCGATGTCCAG
GGCCGCTCAAGCACGGCTACAGCCACTGTGGAAGTACGAC
CTGATCCGCGTGAGCGAGAGGAGGTGGAACTTGAGCTGCA
GGTGAGCGTGGCTCAAGTCAGTCAGCAACAGAGAGACACA
GTGATCAGACAGCTGGCCGCACTTCTGCATGTGTTGGACT
CAGACATCGCACTAAAGGCTCTACATGGACAGTCTGACAT
CAGCACAGTATTCAGGTTCTCGGTGCAGGGTCCTGATGGT
TTGATCCCTGGCCCTAAACTTGCCCGCCTGCTGAGAAACC
AGCTGTTGAGAGAGAAAAGCGACTTCTTGCTCTTTAGGGT
CTTAAGAGTGGACACAGTCATGTGTTTGCTGCTGTGTTCT
GGGCGTGGTCAGTGTGACCCCATTACAAAAAGCTGTTCCT
GTGACCCTCTGTGGATGGAGAACCCCATCCGCCTCTTCAT
AGACGATGGAGAGAGCAATTGTGACTGGAGTGTGCTGTAT
GTCACAATCTCTTGTTTTGTGACAATCATTTTCATCTTGT
CCGTCAGCTGGATCTGCGTCTGCTGCTGTAAAAGACATTA
AACACAGAAGCACAGAGCACAACTCTAGCCTGATGATGTC
TGAATCAGAGCTGGACAGTGAACAGGACAACATTTACAAT
TACGGGAGAGTCCAAAAAGCTCATAACAGAATCAGAAACG
GAGACACTCTCAGCCTTTGCCCTGTGGAGAGTTGAGTCGC
ATGGACAAAAGGACATTTCTTCATCGTGGATACTTGCAGC
ACAGGGGTATTGCTGAATTTACCACTAATACAAAGACAGA
CAGAATTGAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations