Transcript

ttc29-202

ID
ZDB-TSCRIPT-100915-1291
Name
ttc29-202
Previous Names
  • ttc29-001
  • ch211-256m12.5-001
  • si:ch211-256m12.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046401 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046401|OTTDARG00000033082|ZDB-GENE-100922-181 ttc29|OTTDARP00000036598 CH211-256M12.5-001 LG_none CR385082.11,BX927222.8 Danio rerio protein_coding KNOWN, 1623 bp
CGCATCTTCATACAAAGTAACGTGTCTTGTTATATCTGTC
GTTTTTAGCTAAATTATAACTTCTTTTTTGTTATTTAAAC
TTACTCAGCAGCATGTCTTCGAAAACTCGGTTTTCTATGA
TCCACAGTCCTCAGAAAACCAACAGGACAACACCGACATC
CAAGTCTTTCCCTCGGTGTAATAAGAAGAATTCCGGCAGT
CCTGTTGGAGAGGAACCAAACAAAATGACTGAGACCGAAA
TAGCACAAATAGGGAAGCCTTTGCGTCAGAATATTTGCGT
AGAGATGCTTCGAGACGGCTTTCCACACTCATTTAAGGAG
CTGTTCGCACTTCTGCAGCGCTGGGATGAAGAGGACGACG
ATCCGCTCAAACTGCAGACTCTACAGCTTCACCTCACTCG
GGCTGAGGCAGCAGAGAGATCTGAAAAGTATGATGAGGCG
TATGAGAACCACATGCTTATGGCCAGGTTTTTCACAGAGG
ACAAATGGATGAAGCATCATTTCCTTGAGCTGGCACTCCG
TTCAGCTCGCAAGGTCATAATGGACTCTGGCAAAAGAGAA
GCTGAGGCCAGGTCACTTGTGGGACAAGCTTATTTAGAGA
AAGGTGATCTTGAGCTTGCACAAGAGCATTTGGAGGTGTT
TTATCAGCTAACCGCAGGCCGAACTTGGCAGGACAGCAAC
GGCCGGATGCAGCACTCTCGCTCATGTGAAGAGCTCCAGA
CGGTCTACACGCTGATGGCACAGAGATCTCTGCAGGATCA
ACAATATGAGCAGGCCATTAAGATGTCTAGAAAGGCCTAT
ACTATTGCTAAAGAGTCGGGAGATCGAGCGCTGGAAGGAG
AGGCCGCCTATAGACTGGGTCTAGCCTATCAGAGCACAGG
AGACCAGAAGATTGCTATGAAGGTGTGTTCGGACTCACTA
ATTTGCTTTCGACAGTTTTTAAGCTCATATATGGAGATCG
CCTTGACACTTGAAGACACAGACAGTCTGGGAAGAGCACA
TGAAGCCATGGCCAAATGTCTGGAGAGTGAAGGCAAAATA
ACTGAGGCAATTGAATTATGGGAGAAGTATGTTGAGACAT
GTAAAAGCAGCAAACATGACCAAAACCTGGAGAGAGCCTA
TATGAACCTCGGACACATCCTCAAATCTCAGAAGCGGTAC
GGCGAAGCTCGTGTGTATTTTGAGCGCGCGTTTGAGCTTG
TCTGTCTTGAGGGTTGTCCGAGGAGAGTGCAGGAAGCTCA
GGTGTATGTGGGCATTACTCGTGCGCTCAGCACTTTTCCC
GCATATATGAAACTCATACAAGACCAGAACTTAGACGCAC
TACTCGCCTGGAAGGACAGGCGAGAGGACCGCTTCAGTTC
GGCAGCATCAAGTGAGCCAGAGTCAACAGCTCTGTCTAAC
ACTGTCGTTCCATGACTCGCACTCTCTACTGGAAATGAAG
AGTGGACTGATGAAATGTCTAAATAAAGTATTGGGTTAAT
GAGCCCTTTTGGTTTAAAGGGCTCTAATTTTAGTCTTTTA
ACAAGATGTTAAATAAGTCTGTGACATTTCGTTCCACTGT
AGGTCCACGCTTAAACTTAAACTGTATTGTCAACAATATC
GTTATCGCAATAAACGCCAAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations