Transcript

ypel3-202

ID
ZDB-TSCRIPT-100915-127
Name
ypel3-202
Previous Names
  • ypel3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045880 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045880|OTTDARG00000032780|ZDB-GENE-030516-4 ypel3|OTTDARP00000036201 ypel3-002 LG_none FP016243.4,FP016144.3 Danio rerio protein_coding KNOWN, 869 bp
TTATCCATTACCTCTCACCCCTGTTTACCCTCGTGCCTGG
CGGGCCATATATGGGGGAACTACAGTGTGGGCAGCCAAGC
AAAACATGGTGAAGCAGACCAAGGCCAAAACTTTCCAGGC
CTATCTGGACTCCTGTCATCGTCGCTACAGCTGCGTCCAC
TGCCGGGCACACCTGGCCAATCACGATGACCTCATTTCTA
AGTCCTTTCAAGGCAGTCAAGGACGAGCCTACCTGTTCAA
TTCTGTGGTGAACGTAGGTTGTGGTCCAGCTGAAGAAAGG
CTGCTGCTTACTGGTCTTCATGCTGTGGCTGATATTTATT
GTGAGAATTGCCACACCACACTGGGCTGGAAATACGAGCA
GGCCTTTGAGTTGAGCCAGAAGTATAAGGAGGGCAAGTTT
ATAATTGAATTATCTCACATGATTAAGGATAATGGCTGGG
ACTGAAGCTTTGTATTTAACTTGCTGTCACCGCTTGCAGC
TTCTTCAAGATCGACATGAAATATGCTTTTTTTTATTTGT
ATATATATATCCATTTATGATGTACATTACTATTGTGAGC
ACCTTTTTCCACACTGATATCCCAATGCACCAGTTTTTCA
GAGAGGGGGTCTTGGGTTGTTTTGTTTGTATATTTTTTTA
CATGTGTGTTTGTGTGCGAGGCATGCTTTAGAGAAGCTGT
GCTAATATCTTATGATCCACTTAAATCCAGTTTTGAAGAT
TTCTTGATTTTTGTTGGGATTTTGACGTTAGCCCTCAAAT
TCTCCAGATTAAGTGCAATTGATGAGGTTTGGACGATATA
TGATCAAATTTGAAGATCCTTTTTTTATTCGAATCGTTTT
TACTTTAGAGAACGAGTTTTTTTGAACGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations