Community Action Needed: Please respond to the NIH RFI
Transcript

slit1b-202

ID
ZDB-TSCRIPT-100915-1210
Name
slit1b-202
Previous Names
  • slit1b-002
  • slitb-001
  • ottdart00000046100
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046100 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046100|OTTDARG00000032925|ZDB-GENE-030722-4 slit1b|OTTDARP00000036381 slit1b-002 LG_none 17349 CU550731.14,CABZ01050653.1,FP885915.5,CU855898.6 Danio rerio protein_coding KNOWN, 1919 bp
AATCCTGAGCTATAACGCTCTGCGCTGTATTCCTCCTCTG
GTGTTTGGTGGTCTCTCGTCTCTCCGCCTGCTATCTCTAC
ACGGGAACAACATCTCTGAGCTACACCAGCAGATCTTCAG
AGACGCCGCGTCACTTTCACACCTGGCCATCGGTGCAAAC
CCGCTGTACTGTGACTGCCGGCTGCGCTGGCTCTCGGACT
GGGTGAAGAGCGGGTACAAGGAGCCCGGCATCGCCCGCTG
TGCTGGACCGCAGGGTATGGAGGGAAAACTACTGCTGACA
ACACCTGGAAACACCTTTCAATGCACAGGTCCAGTGGATG
CGTCTGTGTCTGGGAAGTGCAGCCCGTGCTCGTCAAACCC
CTGCCAGAACCAGGGCCGCTGCCACAACGACCCCCTTCAC
CAGTACAAGTGCAGCTGTCCACAGGGATACAAGGGCAGGA
ACTGTGAGCTCTCCATCAGCGCCTGTGAAGCAAACCCATG
TGTGAATGGAGGAACCTGCAGACCTGAAGAGTCCAGAAGA
GGATTCAGGTGTGTGTGTCCTCTGGGTTTCGAGGGTCTCT
TCTGTGAGCTGGACGTGGACGACTGTGTGGACCACCAGTG
TGTAAACGGCACCATCTGTGTGGACGGAGTGGGAAACTAC
AGCTGTGTGTGTGCGCAGCCCTTCTCCGGACAGAAGTGTG
AAGAGTATGAGGAAGATCTCTGCTATCCTGGACAGAATCC
CTGTCAGCGGGGCTCCACCTGTATACCCACCGTCAGCGGA
CCCAAGTGCATCTGTCCGCCTGGTTTCGTGGGTGACGACT
GCAGTGTGGACTATAACGAGTGTGAGGGCCATTACTGCCA
GAATGGGGCCCGCTGTGTGGATCATGTGGCTGGATACACA
TGTGTGTGTCCAGCAGGCTACAGTGGTCGCCTGTGTGAAG
CGTCTGTGTCGGCCTGTGATCTGCTGCAGTGTGTGAACGG
CGCCCCCTGTGAGGAGATTTCTGGCACTGCAGTCTGTCAG
TGTCTGCCGGGCTTCAACGGCCTGCGCTGTGAGAAACTGC
TGAGTGTCAACTTCATCGACAGAGACTCATATCTGCTGCT
GCTGAGAGATGCTACACAATCTACACACAACAACATCACG
CTACAGGTCTCCACAGCCGAAGACAACGGGATTCTTCTCT
ACAATGGTGTTAATGAGCACATCGCTGTGGAGCTGCATGA
CGGCCATGTTAAAGTGACCTACGACGCTGGACGGCAACCC
GGAAGCACCATTTACAGCTCTGAAATAGTGAACGATGGAC
AGTTTCACACTGTTGAATTGGTTACTTATGAACGGATGGT
CAATCTTTCCATCGATGGAGGACTTCCCACAACTCTGGAC
AGTTCAGGACACATCCAGCCGCTCACCAGAGACGCCCCGC
TATATGTAGGCGGTATGCCCGAAAATGCCAAGTCGCTGTC
ATCTAACCACTGGCCCCCAGTGAACGGATCCAGTTTTCAA
GGCTGCATCCGAAACCTGTACATCAACAATGAGCTGCAGG
ATTTCACACAGACTCAGATGAAGCCCGGTGTGGTGCCCGG
CTGTCAGGCCTGCCAGGAGCTGCTCTGTGTGAACGGACTG
TGCCAGCCGGACTCCGCCATCGGCCCAGTGTGCCACTGTC
AGCCAGGATGGGGCGGAAAACACTGTGACCAGATCCTGCT
CACTGCTGCCGCTGCCACAAACCCCTGCCAGAAACACAAG
TGTGTTCATGGCGTGTGTGTAGCAGTGGACCTGCAGTCGT
ATCGCTGTGAGTGTGTGGAGGGTTTTCACGGGCAGCTCTG
CAGTCAGCAGGATCCCTGTACAGCTCTCTCATGCCAACAC
GGCCTGTGCCAGATCTCTCCGACGGGACAGCCGCAGTGTG
TGTGTGACAGCGGATACAGCGGACAGCTCTGTGACATCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations