ZFIN ID: ZDB-TSCRIPT-100430-2
Transcript Name: rnu6-4-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: snRNA
Annotation Status: published
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
ZFINNUCL0000002173 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>lcl|ZFINNUCL0000002173|ZDB-TSCRIPT-100430-2 publishedRNA rnu6-4-001 snRNA published 107 bp
GTGCTTGCTTCGGCAGCACATATACTAAAATTGGAACGAT
ACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACG
CAAATTCCGTGAAGCGTTCCATCTTTT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rnu6-4-001 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources:
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)