Transcript

fam89b-201

ID
ZDB-TSCRIPT-091110-906
Name
fam89b-201
Previous Names
  • fam89b-001
  • ch211-222e20.4-002
  • ch211-263p13.8-001
  • si:ch211-263p13.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043203 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043203|OTTDARG00000031072|ZDB-GENE-091204-269 fam89b|OTTDARP00000034254 CH211-263P13.8-001 LG_ CR545465.14 Danio rerio protein_coding NOVEL, 959 bp
GGATCATATCCACTGGCAGGGCTTCGTTTTTATCTCCAGT
ATTACTAACGCGCTGATTTACGAAGACATGCAAATAAGGA
CAAGCGGAAAATTGCCTCCTCCTGAAAGAGCAGAGATTAT
TGAAGAGGAATGATCTAATAGTGTAAACGAGGTATTGTTT
ATAGTTTCTTCAAAAGCAGAGGATACATTGAAGAACAGCG
CTGACGCACTCTTCTGTTCATTTTTCCGGACATTTGATTT
GAGCGGTGACAGTTTGTCGCATTTATAAAAGGTCATCCGT
GTGCTCAAAACACCTTAAATATAAGAAAGGCTGTGCATTT
AATATCAGTTGGATATCTTGGAAATACATGAACAAAACAA
CAGCACCGGGCCTGATATAGTGAGAGCGTGTTTGTATTTT
GAGGAGGGAAATGAACGGGTTTCAGTGCAGTCCAGCGGAG
TGTCCGGCTGGCAGCGTCTGCCCCGTTGAAGGTTTGCCCC
CGTTACCGAAAGGACTGAGCGGTATCCTAAACTCCAGCGG
CGGGTCCTGGCGGGACATTGAGAAGGTCTACAGCAAGAGG
ACCCGCATCCAGGCGGACATCAGCAAGTCCAGGGTCAGCG
ACTGCCTCGAGCGCAGCAAACCGGCCAGTCTGGACGCAGC
GCTGGCTGTTCTGCGCAAAGACATGGTTGGCCTCCGGCAG
TTAGACATGTCCTTGCTGTGCCAGCTGTGGTCTTTATACG
AGTCCATCCAGGAATACAAAGGAGCCTTCCAGGACATCTC
GTCCTCCCTCTGCGAGAGCTCCTTCAACACCGAAAATGGT
TATTCTGAAGAAGAAGAGGAGGAAGATGAAGACGACCATG
AAGCAGAGAGAGGAGACACACCGCTATCCTTTCCTCAACC
CGCACAAAACTCCAGAGACCAGTGGATCAAAGACTCCTTC
CACATCCCCATTTAAATCAAGCATGAGTCCTGGATCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations