Transcript

sh3bp2-201

ID
ZDB-TSCRIPT-091110-881
Name
sh3bp2-201
Previous Names
  • sh3bp2-001
  • ch211-237l4.9-001
  • ch211-241o7.3-001
  • si:ch211-241o7.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043111 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043111|OTTDARG00000031008|ZDB-GENE-091204-268 sh3bp2|OTTDARP00000034187 CH211-241O7.3-001 LG_ CR628386.8 Danio rerio protein_coding NOVEL, 1485 bp
ATGGCTGCACCACCGGTCTCCTGGCCCATTCCCATGAAGG
CTATCGGAGCTCAGAATCTGCTCACCATGCCTGGAGGAGT
CAACGCATCTGGATATCTGCACAAGAAAGGAGGCAGCCAG
TTCAGCCTGATGAAATGGCCTCTTCGCTTCATCATCATCC
ATAAAGGCTGCGTCTACTATTTCAAGAGCAGCACGTCTGC
TGCACCACAAGGAACCTTTTCTCTCAACGGATACAACAGA
GTCTTGCGAGCAGCAGAAGAAACAACATCAAGCAATGTTT
TCCCTTTTAAGATCGTTCACTTCAGTAAGAGACACAGAAC
ATGGTATTTCTCAGCTGCGAGTGAAGATGAGAGAAAGGAA
TGGATGCGGCACTTAAGAAGAGAAATCAACTATTATAATG
ATAAAAAAGACATCCCACTTCCAAGTGATGATTTGGATGC
GGAGTCGTTATATGGACAGCTGGAGGAAACGGTGGAAATC
AGGCCTGTTGAAGAAGATCCTGAAGAAGGTCGACCCACGG
TTCCACCTCCATCGTATCCACCACCGCCAGTTCCGTTTCA
GTCGTCTAGAGAAACCCGATCGAAAGGACCTCCGCCTCCT
CTACCACCTCCATTCAAGAAACCGTCCTGCCACATCAAAG
ATACTCCTCCTCCACCTCTACCGTATGCCCCGCATCTGGA
GAAAACAGACTCAAACAGACGCCCTGTCAGCCCCATGCCC
CCTTTACCTCCTCCTGTCAGTCTTAAACCTCCGCCAGGCC
CATTCTCCACAATGCCTGCCTGCGAAAAGAAGTCCAGCGT
CACTTTTAATCACTCACCAGCCACTTTACCCATCGTGGAG
AACCTGCAGAAAGTGATGCTGATCTCTGCAAGTAAAACAA
GCATTTCGGGTCATCATTTGGAAGTGAAGCCTTCATTCGG
ACAAAGGCCGCTTTCACCTCATCTGTCCACAAATCACAGC
ACTCTGGGACAGATAAACAAGCCCCCAGTGCCAAACAAAC
CCAAACCCGGAAGACCCTCATTCCAAAGAGCATCGCCGGA
TGGACAAAGTTTTCGTTCTTCTATTGAAGAGAAGCCTCCA
AAACGAATTCCAGACAGAATTGATGAAAGCTCAGATGAAG
AGGACTATGAAAATGTACAATTGCCTCCCTCTGTCTTTGT
GAACACGATGGAAACCTGTAACGTGGAAAGACTTTTTAGA
GACACATACAATCAGCCGCAGAATGGACTGTACTGCATCC
GAAAATCATTAACGGGGAAAACGTCACAGGTACTTGTTGT
TTGGGACTCTGGAATAAACAAAGCCAGAAACTACAGGCTT
TTTGAGGAGGAGCAGCGTATTTATCTGGAGACGGACGTGA
CGTTCACCTCTTTAGCTGCTCTGGTTGAACATTACCACAG
TCACCCACTGCCCAGCAGCAACAACTCCATGCCCAATTAC
TCGCTCTGCTTACATTTACCATTCGGCTACACCCCGCCCA
GGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations