Community Action Needed: Please respond to the NIH RFI
Transcript

inpp5ja-201

ID
ZDB-TSCRIPT-091110-832
Name
inpp5ja-201
Previous Names
  • inpp5ja-001
  • ch211-199i18.10-001
  • dkey-106l3.7-001
  • ottdart00000042924
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042924 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042924|OTTDARG00000030891|ZDB-GENE-091117-4 inpp5ja|OTTDARP00000034071 CH211-199I18.10-001 LG_ BX294661.14 Danio rerio protein_coding NOVEL, 1198 bp
ATTGTCACATGGAATGTAGGCTCTGGTATGCCACCTGATG
ACATCACGTCCTTGTTTGGTCCTGGCATTGAAAATGGAAG
CACTGACATGTTTGTCGTGGGACTGCAGGAAGTGAACTCC
ATGATAAACAAGAGGCTCAAAGATGCTCTCTTCACAGACC
AGTGGAGTGAGCTCTGCATGGACACACTCAGTCGATTTGG
ATATGTGTTGGTGGCTTCTCAAAGGATGCAGGGGGTGTTT
TTGCTGGTGTTTTCCAAATTCTGCCACCTTCCCTTTCTCA
GAGGAGTACAAACCCAAAGCACACGCACCGGCCTGGGAGG
ATACTGGGGGAATAAAGGAGGTGTAAGTGCACGCATGATG
GTTTTCGGACACCCCGTGTGTTTCCTAAACTGCCACCTGC
CGGCTCACATGAGAAACCTGGAGCAGCGCATGGAGGATTT
TGAGAGCATCCTTCAGCAGCAGCAGTTTGAAGGCAGCAAT
GCTGTTGGCGTCCTGGACCATGATGTGGTGTTCTGGTTTG
GAGATCTGAACTTCCGGATTGAAGGTTATGATATTCATGT
GGTGAAAAGTGCTATTGAGAATGACAAACTGCCTCTATTG
TGGGAGAAAGATCAGCTCAACATGGCCAAAAAGAGTGAAT
CCGTCCTGGAGGGGTTTATAGAAGGACCTCTCAAGTTTCC
ACCAACATATAAGTTTGATGTTGGGACACACACTTATGAC
ACGAGTGCTAAAAAGAGGAAGCCTGCGTGGACAGATCGGA
TCTTGTGGCGTCTGCGTAGGACAGGCTCCCCCGTCCCATC
CCATAATTCAGCTCTGCAGCTCTCTCAGCACTTCTACTGC
AGTCACATGGGCTTCACTATTAGTGATCACAAGCCAGTGT
CTGCTCTTTTCTCTTTGCACTTTCCCTTTAAGGTGACCTT
GCCATTAGTGACACTGGAAGTGGAGAAAGAATGGACCAAG
TTCTCTGATGCAACAGTCAAACTCACAATGGCACATGGCT
TTCAGAGGAGTTCATGGGACTGGGTGGGCCTGTACAAGGT
GGGATTCAAACATCACAAGGATTATGCTGCTTATGTATGG
GCCAAATCCGAGCATTCCACCCAGGTGGTATTTTCAGAGG
AGGATCTGCCAAGAGACCCGGGGGAATATATTTTGGGATA
TTACAGTAACAACATGAACAGCATTGCAGGAGTAACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations