Transcript

itga2.1-201

ID
ZDB-TSCRIPT-091110-820
Name
itga2.1-201
Previous Names
  • dkey-27b3.6-001
  • itga2-001
  • itga2.1-001
  • ch211-126i22.5-003
  • ottdart00000042887
  • si:dkey-27b3.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042887 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042887|OTTDARG00000030870|ZDB-GENE-111011-4 itga2.1|OTTDARP00000034046 DKEY-27B3.6-001 LG_ BX571955.15 Danio rerio protein_coding NOVEL, 835 bp
TCGCTTCACTGTGACAGTTGGATTGAAGACAGCGCCTTCA
GCTCTCTCATAATATTTTTAAGCAATGGACATAATGGAAA
AGGCTGTGATTCTACTGGCATTACTGCAGTGTTTGTGTAT
TGCTCGCTCTCTGGGTTTTAATGTGGGGACTAAAGACGCC
ACAATCTTCTCAGGATCTGCAGGACAAGAGTTTGGATACA
CTGTACAACAGTTAAGCACTGACCAAGGAAAATGGTTATT
GGTTGGTTCTCCCTGGAGTGGATTCCCTCGAAACAGAAAA
GGAGACCTTTATAAGTGTGACATTGGTGATCCCAGAAACC
CCTGCCAGAAACTAAACTTACAGGATTCTGTCATCATTGA
TGGTGTGCAGAGTATCAACACCAACACGAGTCTGGGTCTG
ACTCTCATTCCTGTGAAAAAACGATTTATGACGTGTGGTC
CTCTGTGGGCTCAGCGCTGTGGAAGTCAGTACTTTTACCC
AGGAGTCTGTGCTGAAGTGACTCAACGCTTTACTCTCAAG
TCAGCCTTTTCGCCCGCTATTCAAATTTGTGGTGGGCCAA
TGGATGTTGCCATTGTTTTAGATGGATCGAACAGTATTTA
CCCCTGGTCTGATGTTAAAAAATTTCTCTTAAACCTTTTG
GAAAACCTTGATATTGGACCAGATCAAACTAGAGTAAAAC
AGGCTTTCCTACCAGAAAACGGTGGGCGTCCAGGTGCCAC
TAAGGTGCTGGTAGTGGTGACAGATGGAGAATCTGCTGAT
GGGTATAGAGGTCAAGAAGTCATTCAGAAACTTGACAGAG
ACGGCATCATTCGCTTTGGAATTGCTGTGAGTCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations