Transcript

smcr8b-201

ID
ZDB-TSCRIPT-091110-775
Name
smcr8b-201
Previous Names
  • smcr8b-001
  • ch211-12h2.6-002
  • ch211-160d14.5-001
  • ottdart00000027329
  • si:ch211-160d14.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027329 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027329|OTTDARG00000021467|ZDB-GENE-061122-1 smcr8b|OTTDARP00000022384 smcr8b-001 LG_none AL928835.6,AL928650.5 Danio rerio protein_coding KNOWN, 3662 bp
ACATACTTGGGTTCATCTCATGTTGAATTTTAAATATATT
TTCACTGTTTGTAGTTCTGTAACAAGTCAGTCAAGAATGT
TTATTTATTTATTTATTTATTTAAAAAGTAATAATTTAAA
TGTTCTTTAAATGCTGCTGATTAATCAATAAAGACATTAA
CAGTCTTGCTGAAGACTTTGAGGTAGTTAAATATATAATA
ATTATATGTTTACACAGTCCTCATACCTTTACCTGAATAT
CATTTCATAATACTTTTCACACCCTTGTCTGGTTTGTTAA
AAACAATTCGTGCCACTATGATTGGGTCTCCAGACTTGGT
AGCTTTCACCAAAGAAACAGATTTCAGTGAAATAACCACA
GACTCTTCGGTACTTCCAGAGGATCTGTCTGTGCCCATGT
ATCCATACACTGGGGATGCCACCCCATGGTCCAAGATATC
TAGTGCCAAGTTAAAGAAAGATTTCATCCTCATATCAGAG
TTTTCAGAGCAAGTTGGCCCCCAGCCATTACTTACAGTTC
CTCTTGAAACTAAAGCTTGTGGGACTTTTGATTTGAACTA
CTTCTCTCTTCGGATCATGTCAGTGGACTATCAGACTTCC
CTGGCCGGCTCTCCAGGTTACGGTTCCTTCAAGCTGAACT
TTGTAGAAGACTCAAAGGTGGTTTTAGCAGACTCAAGAGA
AGGAGTATTTGCATATGTGCACCACCTGACCCTCTATGAC
CTGGAGGCTCGAGGTTTTGTGCGGCCTCTTTGTCTTGCCT
ATGTGTCGTCTGATGAAAATAAAATCATTCAACAATTCCA
AAGGATTTCCACAGAATTCAACAAAGTCTCAGAATGTCTG
AAAACTGGAAACAGGAAGAACTTTGCGAATGAACTGGAGG
TAAAGCTTAGAGATTTGGAGTATACAAGAGTCGTGTTACA
GAAAGAGTTAAATACTGTGTCTGTAAAGTGCAGCAGTGAA
AGGGAACCAATATTAAATGGTGTACATTCATTTGAGAGGA
ATGCAGATGAGGTGAAACTGAACGAGAAATCCTCTCACAC
AGATGAAATCTCACCGCAAGAGAAAGACGGATGTGGGAAT
TCTAGAAAGGTGGAAGTGAAGCTTGAAAATGAGAATAGGT
CACATTTTGAACTTGAACAGTACGGGAAACAAAGAAAGGA
CAAACCGGATAAAACATCATGTCCAATGCCTTTGGCTAAC
AAAAATGATGAGTTGGCCAGTGTAGAAAAACTGATTCAAG
ACTATAAAAGCCTTCTAAAGCAGGTCACTTGTTACCCAAC
TAGAAAGCTTAGAGACTCTGAATACTCCCCTTATGAACCT
GATGACCTCCCTCAGTCTTTTGACCTCGACCTGGACAGTC
AGTTTTCCGGGCCAATGCTAGAATGCAGTGTTTTTACTTA
TACAAACACACCCTCACAAACTCTGCAGCAGATTAACTCC
ACGTCATCCAGCCGATTTGACAAGCGTCTGAAAACTCTCG
AGGAATTGTGTGATGACTACTTCTACCAACAAGCACTGCA
GCAACTGTACTCTATCGAGAGAACGTTCAGAGGTGACGCC
TGCTATCTCTACACTCAACAACTCTGCCGAAATCTCCTCC
GCAACCTCAAATCTACTAATTTCTTGTTTGAGGATCTGTG
CGACCTGAACGATGATGTAGGGTTACAGATTGGGCAAAGC
ACAATCCAGCAAACATCCTTTCTTCCTGCACCCTCATTTC
TAAGTGGACCGGTCAGTCTTGAGTCATACGCATCTTGTGT
TGAAATGGTGCCAATAAAACTTGAGTTGGGTGGATCCAGC
CAATCTCAAGTTCAACATAGCACTTTAAATACACCTTCAG
AGGACAACCGACCCCAAGTAGCAGACAAATCCCCAGCAGA
GGTTGAGATGAAAGATGAGATCATTTCAGCTCCAGATTGT
CAAGGAAATGTGGAAAGTGTCTCGAATTTGATGAAAACCA
GTATTAGTAGTGGAGACAGTATTGAGGTGTTGGGAACAGA
GAGGTCATTTAGATCCCAGGGGGCAAATACGCCAGTGGAA
ACAGCAATGCACAGACCTCCACCTTTGTCTAGTGCCACTG
CACTGGAAGGTCTAAAGCAAGGAAGGGTGCCTACCAGACG
AACATGCAGTGAAGACAGCATTGAGGTGCTTTGCATAACA
GAATCCATCTTACCTGATGAACTGCGTGCCTCATACCCCT
GCGCAATTGATGAAGAAAGCCCAGAGCAAGAGACTGATGA
GAAAAACTCGTCTCAATATCAAGAAGACAACAATGAAAAG
AGTATATATGTTCAGGGAAAGATCTCTGCAGATCATGAAA
ATGCATGTTTGAAAAAGCTACATCCATCAGTCACTGTAAC
CCCACCAGACTGCCCTTTGACTCTAGAAGAAACAAGCTTT
CAAGACTCTTGTCAAGCAACAGAATCAGCCACTATGTTGT
TGTTAGATGAGCCCAGCCGGATGGTACCTGACGATTTATC
AGACTGCTTCAGCTATCGGAGCACCACTGCATCCACGACC
TCCGAATGCACTTTCCCTGCGTGTCTTCCCAAGGACAAAA
GAGAAGGTGGGACCAGACGGAGACGAGGCAGAGTAGGAAG
AGCAGCACTTCAGTTCATGCGGCAGTTTCCCTTTGCAGTG
CATGCAGTGTTTAGCCTTCTAAGTGGCCGAACATTGGTGG
TACTAGGAAGTGAGGAGGCTGCTGTGAGACGACTAGTTAC
AGCACTGTCCGTGTACCTGCCACATCTGACTAAATACAAA
GACAGCATCCAGCCTTGGACTTCAACACCACTGCAGCTTA
CGGACCTGCTCAACTGGAAACTCATTGGTTTTGACAGGAT
GTGCAGTTTTAATCCCTCAAGTCTGCCTCACTGCCTGGAC
CATTACAGCCGGTACCTCAGTATCCTAGATGTAGATCAAA
AAACCCTGCACTGCCCGACCTACAGTGGTTCTCTCATCAA
CCTGCTGGTGGAACCCAAGAGCCACTTTAAACGTGGAAAC
ACCTACTTCACATTCGCTCAAAGTGTGCAAAGCAAGCTCG
TCACCAAAGCATTCCTCTTAACATTCTCACATGGTCACCC
TTCACCCAGCAGGCCCCAGGGAAGCTCAGGGACAGAATGT
TTTCTTTCTGAACTTCACACTGATGACAAGAAAATCCTTC
GCTATTTATCTGAACTCATCAAACTGCACTTCATGGAGGT
TACTCCCAATGTGCTCCTATTCAGCTACACCACAACATCC
ATCTTCAAACTGTGAAAGTCATTCACAAAAACTACTCAAA
GATTTGTGCAATGTAGTGTTGTAATACTTGGCTTTGACTG
CAGACACAAAGCTGTGTTGCTCAGCTTTAACATTATATTT
ACAGTTTCTGCATGTTGTGATATCTTGTTTACAAAAGGCA
CTTATACAGTAATTATGGCTTAATTGCTTGTGAAAAGTTC
CCTGAGAATTGCAATCATTCACAAGCTTAAATGAGCTACT
GTATAACAAAGCAATATTGAACAGCTCTGTATCAGTTGCA
TTTGAATCTTAACTATTTATTTACAATACCACTAATGTTT
AAAGACTTGAAACTCTGTTTGCTGAATATAACTGTGCAAA
TAACAAAATCAGCCTTATTAAAAAGTATAAGAAATAAAAA
ATTGATCTTAACTACAATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations