Transcript

luzp2-201

ID
ZDB-TSCRIPT-091110-673
Name
luzp2-201
Previous Names
  • luzp2-001
  • ch211-243k12.1-001
  • dkey-30j10.3-001
  • ottdart00000045313
  • si:ch211-243k12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045313 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045313|OTTDARG00000032438|ZDB-GENE-060503-278 luzp2|OTTDARP00000035809 CH211-243K12.1-001 LG_none CU570771.9,CT027579.23,CR381582.9 Danio rerio protein_coding KNOWN, 2641 bp
GCATGAGAGCAAGACAAAGCAATGAAATTCATCGGAGCCG
TTTACCTCCTGTTCCTCCTCCCTGCTTTAAGCTTCAACAG
CAGCTATGAGGGGCTGGAAAAGAAGCTGAAGGAGGTTTTC
ACAGAGAGGACAGGAATTTTACGACATCTCTCCAAAACAT
CAAAGGAACTGGACAGCATAAAAGGAAACCTGCAGTCACT
GAAGAATGAGGATGCTGTGCCCAAGAAGGATGTGCAGAGG
ATCCTGGAGCTCAGTCACAAGCAAAGGGATGAGATGAAGT
CACTCCAGGCAGCTCTGCAGAAACAACTGGATGATGCAGC
TGAGCGTGCAGAGAAACAGCAGGCCACTATAAAGTTCTTA
AAGATGGAGATGGAAAAGAAAACGAAAATCATCAAAGACC
TTCAGCAAGAGAATAAAAGCCTTAAGAACAAACTTCTGTC
CGGGAACAAGCTCTGTGACATTCATGCAGAAGAGTCCAAA
AAAATCCAAGCCCAACTGAAAGAGCTGAGGTATGGCAAAA
AGGATTTAATTTTTAAGGGTCAACAGCTGATGGACTTGGA
GAACAAACTCAAAGTAGCCAAAGATGAACTGGAGAAGGCA
GCGCTGGATAAGGAGTCACAGCTAAAAGCCCTGAAGGACA
CAGTGCATATCTGCTTCTCGTCTGTTCTACACAGCCAGAC
AGCAAGTTTACACAGATTTCCAGCCACACCAACCAACCTG
TTGAGGTATTCAGCCTTGGTCAACAACTCCAGAGTCACCT
TTCAGCAGCCACACATGAAGGTGGGATCAGATTGTTCCCA
CAATCAGACTGAAAGCTCATCTGTGATGAAAAAGACATTT
GGACACAGTCAGTCGAAGACCCCAGAGCAGAACGGACAAG
GCCAGGCAAGGACAGCAGAGGAAAGTGTGAAAACAGATGG
GGAGCTAAAAAAGACACAATCGGACAAACACAACTGAAGG
GACAGTGGAAGACTTGGCAGATTTTCTGCATGGTAAAAAA
AATGATGTCAGATCTGTTTAAGCCCCTCTTCGTTCACTGA
GCTTATAAGCACACACACACAGATACATATGCACACAAAC
ACGCGCACACACACACACTGTAGCCAAACACAATCTACAT
ACACTAAATACTCATTCTAACACTGCTAATGTAGAAAAGA
AATTCCCAAAATTAAATTTTGAACTTTCTTAATAAAAAAT
AAAAAATCCCACTGCATAGTATGGCATGCATTATAGAGTT
TTAGATATTGATTTTACAAGGTTACGATGGTACTGGTTGT
TTTTAATAACTGTTACTTTTTTCACTATCTATTTTGTTTT
GATTTTTTTTTCTCTCCCAGAGTGAGGACACACAACGTTC
TTTGATTTGTGTTGTTTGTAATTAAAAACTTTTTCTGGCA
CCGCAGACCAGAATTCAGTGTTAAAGGTCACACTGGGGGT
CATTTGAGTTCTGTAAATTTACACTTGAGGTCAGATTTTA
ACTTTTGTCAAAGCAGCTTCTGAAAATATACTGAGCCATG
TACTGAATGCAAAATTGGGCTGCACGATTTTGGGGGGAAA
ACTGAACTGTGATTTTTTTTTCTAGCACAGACTGATATTT
AACATGTATATATGTTGTATATATTTAATTTTATTATCTT
CTGTTGAGCCGCACACCTCATATTGTGGCCTTGAATTAAC
ATCTGTTCTGTGACACTAATATGTCAGTGCTTTTAATAAT
TCATTCCCTTGTTTTAACTAAACAGTGGGCACAATGTAAT
ACTTTGTTGCCCCGTATTCCTAAATTGTGGCCATGTTGTA
ATGATTAGTTGCCTTGTTGTAGTTAAAACAATATAACTGA
ACATATTATTAAATTGTGTGAATGAATAAAATGAGGGAAT
ACTTTATTACATATTTATAATCTATTCACTTATTTTTGCA
CTGGTCATGTGCAAACATTAAGCTTTTATTATGGTGGGAA
AAGTTCAAGAGAACTTAATCTTCTCTTGTTGAGTGCAGCT
GGTTTAAAGCACTTCTCTTTTCAAACTTGGAGCATGCTGT
GTTGTCAAATGCAAGCCAAATTTTAAGCACATGTTGACAT
GCGTAATCCTGTTATAAAGAATTTACTAGGAAGGAAGCCT
CTTTGAGGCACTTAAAACACTGGATCAAGATATAACTAAA
CACAGAACCATGTTTCATTGAATACTTTTATTCAACCTAA
TCACAAAGTTTGTGATTTGATATTCAAACGAAGCCATGTC
ACAGTTTGTGTTTTATTCCGATTAATCGTGCAGCCCTAAT
GGAAACTGCATCAATCCCACTTCTGCTGAAATGACAAAAA
GAACTGTTTAATGCTGTTCAAGGTACGGTTTGTCTCGTGT
TGTAGCAAAGATTAATTTACTCCTCCTACTCCATATTACG
AGGCTCAAGTTGGCTGGCCAACTATCACTGTTGAATATTT
CGGAGCTTTTGGTGCCAGAATTAAAGAGAAAAACTGGACT
CACAGTGAGTCGTCTCCCTAAGAATGATGTGCCATGCACC
GAGTACTTAATCTACTGCTACATCTCTCTGTTTCTCTACC
TTCTTGTGTCCTTTACAATAAACCGTGATTTTCGCTAAAT
GTGTGAAGAATAAATGGTTATTTGTGGAGTAAAACAACTG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations