Transcript

tmtopsb-202

ID
ZDB-TSCRIPT-091110-544
Name
tmtopsb-202
Previous Names
  • tmtopsb-001
  • ch211-174k6.1-001
  • dkeyp-72f10.7-001
  • si:ch211-174k6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044624 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044624|OTTDARG00000032005|ZDB-GENE-091118-50 tmtopsb|OTTDARP00000035269 CH211-174K6.1-001 LG_ CU302291.7 Danio rerio protein_coding NOVEL, 777 bp
CATTGTTTGGTATTCTCACTACATTGGTGTCTGTCTTCAC
TTCCTGTTCGCCCTCTGTTCATCTTTGCGTTGTGTCTCTA
ATCTCTCTGGCGGTTCTCTCATACGAGCGTTACTGCACCA
TGATGGGCTCCACACAGGCCGACTCCACCAACTACCGAAA
AGTGGTCATAGGCATTGCTTTCTCCTGGATTTATTCCATG
GTTTGGACTCTTCCACCACTGTTCGGATGGAGCTGCTACG
GTCCGGAGGGTCCCGGCACCACCTGCAGCGTCAACTGGGC
CGCGCGGACTCCCAACAACGTGTCTTACATTGTCTGTCTG
TTTGTCTTCTGCCTTATTCTCCCTTTTATCGTGATCGTCT
ACAGCTACGGCAGACTCCTTCAGGCTATCACACAGGTGAG
CAGGATCAATACGGTGGTGAGTCGTAAACGGGAGCAGCGT
GTGCTCTTCATGGTGGTCACCATGGTGGTCTGTTACCTGC
TTTGCTGGTTGCCATATGGGATAATGGCGCTGCTGGCTAC
GTTTGGACATCCCGGACTGGTGACACCAGCAGCCAGCATA
GTTCCTTCTCTGTTAGCCAAGAGCAGCACCGTCATAAACC
CAATCATCTACATCTTCATGAACAAACAGTTTTGCAGATG
TTTCCATGCGCTCATCATGTGCACCACCCCAGAGAGAGGC
TCCAGCTTTAAAAACTCTTCCAAAGTCACCAAAACTCTCA
GGACAGTGCGACGTGCCAACGGCCAGAATGTGACCTTCGC
TGTGGCATCGGCCGTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations