Transcript

endou2-002

ID
ZDB-TSCRIPT-091110-436
Name
endou2-002
Previous Names
  • ch1073-119c15.1-002
  • ch73-68b22.2-001
  • ottdart00000044142
  • zgc:110053-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044142 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044142|OTTDARG00000031683|ZDB-GENE-050522-373 endou2|no_translation CH1073-119C15.1-002 LG_ CU459208.9 Danio rerio protein_coding KNOWN, 837 bp
GCTGTGGTCACTGCATCTTACCCAAACGGTCCATGTGTAG
CAACAGCGCTGTGCTACTCACTATTTTTAAGACAACCCAA
ATCTACCAGTAACCCATACTGCTGAGAGGACCCAGGAATT
ATAAAAAAAGAGAAAATGACTGAAGGTGATCGAGAACTTT
CAGCTTTGATTCAGGAGCTCTGGGACAATGACACCAATCG
CCTGAGACCTGGGATCGATTATCGCATTTCTCTACAGGGT
AAAGCGGGTGATCTGGCAGGTGTTCCCGATGACAGTGATG
GAGCAGGGATGCCTTTGTTTTCATTTGTTGATGAAAACAT
TTTCAAAAAGGAGACTTTCTTGGCTTTCATCTCACTTCTG
GACAACTATGAAAGTGATACTGGTGAACCAGAGATCGTCA
CACCAGAGGAAGAAATGGAAAACCATAGGTTCCTGGATTC
AGTCATTAAGACCCCCACTATGAAGACCAGACTCCTCTGG
TTTTGAACATGTCTTTGTAGGAGAGACAAGAGGAGGTCAT
ACTGTCATTGGGTTTCATAACTGGATTCAGTTGTACTTAC
AAGAGAAACTAGGACACATCGACTACAAAGGTTATAGTGT
GAATGCAAACTCGCCACAGCCAGACGAGAACAAACACATG
CTGGCTCTCCAGTTCAGTTGGAAGAACGGAATTAAGCCCA
AAGGAAGCATCTTCATCGGTGTGAGCCCGGAGTTCGAGTT
TTCCCTGTACACTCTGTGTTTTCTCATGTCTCCAAATGAG
AGAGTGAAAGTCTCGTTTAATCTCTATGATGTGGAGATCG
TGTGTCACCACTACAATCAAAAGCACATCGGCACTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations