Transcript

c3b.1-201

ID
ZDB-TSCRIPT-091110-26
Name
c3b.1-201
Previous Names
  • c3b.1-001
  • dkey-21e7.2-001
  • vg1-003
  • ottdart00000013206
  • si:dkey-21e7.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013206 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013206|OTTDARG00000011327|ZDB-GENE-030131-2211 c3b.1|OTTDARP00000011300 DKEY-21E7.2-001 LG_none BX649330.5,BX890627.4 Danio rerio protein_coding KNOWN, 5813 bp
GGAGGGATTTGGGGATATGTCGATATTTTAGCTGTTTGTT
TTCTAGTTATTTCTGACATATTGAGTGGCGGTTACTTCAG
CAGGACGATGCTTCTTCAGCTGCTGTTATGGGCGACCCTG
CTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAACGAC
ACAAGAGGACGGTTTGGAGACATATGCGACAAATTGAGCC
GGTCAAAGACCCTTCTCCGTCGTTTTCTCTTCTAGCTCCA
GCAAAAATAAGGCCTGGAACAAAACAGAACATCCTGGTGG
AGGGACACAACCTGGCACAGGTGGTAGAAGTCACTGTTGT
GGTTTACGACTATCCAAACTCCCAAACTGCCTTGTCACGG
GGCTCAGTTTTCCTCAATTCAGACAACAACTACAGCGTCC
TGCAAACCCTAGAGATCAACCCAAATTTGCTACTTCCAGA
TGGAAAAAAGAAGTATGTGAAGCTCGTTGCTCAGTTCAGC
AACATCTATCGTGCAGAAAAAGTAATGGCGGTGTCGTTCC
GCTCCGGACACATCTTCATTCAGACCGACAAACCTATTTA
CAACCCTGGAGACAAAGTACGTTTCAGGGCTTTTGTGTCT
GATTTGGAATTTCGTTCTTCTGAGAGAACCATATCTCTGG
AGATTCAGAATCCAGATGGAATTGCGGTGCATGGTATTGG
GAGAGTTAAAGCAATCGATGGGGTCTTTTCTGACATTTTC
TCACTGTCTACTGTAGTCAAGTATGCACTCAGAATAGTTC
AGTTGTGTTTGCTTCCAGCATTCAACGTCACACTTACTCC
TAAAACATCCCACCTTAGTCTGGATGCAGAGAAGTTGGAA
GTTGAAATAACAGCTAGGTATCTTTATGGCGCGCAAGTGA
AGGGTGTTGCGTATGTGCTGTTTGGTATTGAAATTAATGG
TGAAAAGAAGAGACTCACATCTATGAAGCAAATTGATGAT
GTACTAAATGGAGGAAGTGTTAGTTTGACTATGGAGGAGA
TAAAGAGAGCTTATCCTGACATAAACAGTCTTCTGGGGTC
TACGTTGTACGTCAAAGCATCAGTATTGACTAGTTCAGGT
AGCGATCTTGTGGAAGCAGAGAAATCCGGCATTAAAATCG
TAAAATCACCCTACATGCTTACCATTAAGGACACACCAAA
GTATTATAAACCTGGTCTGCCGTTAGCCATGACGGTTATC
GTGAGTAACCATGATGGATCTCCAACTCCTAATATTCCTG
TTAAAGTCACCTTTCTTGAAAGTCCAATCAGTGTCCACAG
TGGCACCATCAACATTCACATCAACATGCCGAAAACGCAC
ATACTATATGGCAATTCCCAGATATTGAAAGTGGAGACAG
TGGATCCGTCACTGAAACCAGAACAGCAGGCCATTCAAGA
GGTATACGTCAAGCCATATTCTACTTTTAGCGGTCACGAT
AACTTCTTGCACGTCTCAGTGGGAGCAAGTCGAGTGGTGG
TCGGTGGCAGTGTCAGTGTCCAAATGTACATCAAATCCTC
TTTACCAAACCACAGAGCCCTCGTGGAGCATCTCACATAC
ATTGTGTTAAATAAGGGGAAAATAATTCAGGCTGGTAGAG
TGAATGTCAAAGGCCAGGATGTAACAAGCGTTCATCTGCT
GATTACCACAGAAATGCTACCTGCATTTCGGTTTGTGGCG
TACTACGTTTTGCCATGGCAGCATAGGGCTGAAGTGGTGG
CAGACTCCGTGTTTGTTGATGTGGAGGACCGGTGTGTAGG
TTCGCTTAATGTTGGACCAGTGGATGGAGAAATAGTCAGT
TCTTACTCACCAGGCAGCAGCTTTAAATTTCAAGTGAAAG
GTGATGTTGGAGCAAAGGTCAGCCTGGTAGCTGTGGATAA
TGCCATCTTCTTGTTGAGTAAAAACCGCCTGACGCAGAAA
AAGGTGTGGGAAGTGGTGGATCAGGCTGATATGGGCTGCA
CCGCAGGAGGAGGCAAGGATAATATGGGTGTTTTCAGTGA
TGCAGGACTGATGTTTCACTCCAGCACAGGAGGTTCAACT
GACTCCAAAGAAGACTGCTCCAGTAAAACTAAACGGCGAA
GACGTTCTGCAGCCAAACTGCAGCTCAGAGATCAGCTCGA
GAAGGCCTATTCAGATGAGCTCCTGCAGAGGTGTTGTGTG
GATGGCATGAAGGAGATTCCCATGCCGTATTCATGCTACC
GTCGCTCTCTCTACATCACCGAGGACTGGAGCTTTTTTTT
TGTGAGGGATAGAGTACTACAATCCATGCCAAAGCTGCAT
GCCGAAGCTAATGTCGTCGGAGTTCGTCAGGACAGTTATC
GGGAAGTCGTTGTAGAAGAAGAAGAAGAGGCGGCTTCAGT
GTTTGAGGAAGATGATTTGTCTGATCTTGAGGATATTTAT
GTGCGCAGCAAGTTTTTTGAGTCGTGGTTGTGGACCGATA
TCAGACTGCCTAGCACTGCCAAGTCTGATGGGTTGGCTGT
GTTTCCAGTGGACACCGTTCTTCCAGACAGTATCACACAG
TGGGGGTTTCTAGCTGTCAGTGCCTCACCTGAGAAAGGTG
TCTGCGTAGCTGAACCGTATAACGTCCGCGTGTGGAAGCC
GTTCTTTATCGACCTGCGTTTGCCTCACTCGGTGTCCAGA
AATGAACAAGTGGAAATCAAAGCTGTAATCCACAACTACA
AGAACTCAACACTGGAGGTACGTTCCACACCATCAGTAGT
GATGGTGATCCTGGAGAAGACAGAGGACATGTGTAGTGTG
GCCTATACGGGACAGCACAGACAGCAGGTTACAGTAGCAG
CCGGTTCCTCTAAACTCATTACATACACCATCATCCCTCT
GAAAACAGGGGAGCTCCCTTTACAGGTCACTGCTGTCGCT
GCCTCGTTCATGGGTCAAGATGCAGTGAAGAAAAATCTAC
GCGTAGTAGTTGAAGGCATTCAGACACTTAAAGTGAGGAG
CTTTGTGTTAAACCCATCAGAGAAAGGAGGCAGTGCTGGG
CAACAGTTGATTCAAGTCAAGAAGATGCAGTTGGATGCTG
TTGTGCCAAAATCTGTACCAGAAACATTTGTCAATGTCAG
AGGCGATTTGCTGGCAGACAGTATTGATAACTCCATTAAG
GAGGACTCGTTGGCAGCATTGATCCGGATGCCCGGAGGCT
GTGTGGAGCAGAACCTGGCCAGAATCACTCTGCCCCTCAT
CGCAGCTCATTACCTGGACCGCAGTGCAGACTGGGAGATC
GTGGGAATCAGTCGCAGAGAAGAGGCCATCAAATACATAC
AGAGAGGTTATGAAAATCAACTTAACTACAAAAAATCAGA
CGACTCGTACCCTCCCTACGCCAATGAAGGCACCAGCACA
TGGATCACTGCGTATGTGGTGAAGGTTTTCTCCATGGCGC
ATTCATTCATTAATGTCAATGAGAAGCATCTGTGTGGCCC
TCTGCTCTATTTACTCAAGAATAAACAGGGTTATGATGGA
ACTTTTCAAGAGGACAATCCCGTCTATGACACCAGTATGA
CGGGAGCTATGCGGGGATCTGAATACAAAGCATCTTTGAC
TGCATTTGTGCTCATTGCTTTAGCAGAGGCACAAGATAAA
GTTACTTGCCAAGATCAAGAAGTCAACATACGGGATAAGT
CTAGACAGGCAGCAGGGTATCTGACAGAGCATTTCTCCCG
GCTGACCAGGCCATATACAGCAGCTATAGCATGCTATGCG
CTAGCCGTATCGAACAACGCCTGCGTGAAGAGCATGTTGC
TCAAATTTGCCTCACCTGATCATTCCCACTGGCCTGATTC
AAACAATTATTTTTTCACACTGGAAGCTACAGGCTACGCA
CTGCTAGCGCTGATCAAAAGTGGCCACATGGAAGAGGCAG
AAGCTCCATTTCGATGGTTGAATGAGCACCGTGGCATTGG
TGGAGGATACGGCTCTACTCAGTCCACCATGGTGGTTCTT
CAGGCCCTGTCTGAGTATCTAGTGAAGAGGCCTCCTCCGT
CAGACCTCAATTTGTTGGTTCAGCTCAGCGTTCCTGGTCG
GAGTGATGTTCGCTGGACCTTCAATCCCAACTTGGCTTAT
GTGGCCCGTTCTTCACGAGTCCCTCTTGATCAGGAATTCT
CAGTGGCGGCTTCTGGGAACGGCAAGGGTGTTTTGGAGGT
AGTGACGGTTTACCATCAGCTTCCTGATGTGTATGAGAAC
AGCACATGCAACGGCTTTCAGCTGGACGTCTCTATCGCTG
AGACTAATGAAAAAACCTCATCGGATGTAGAAAAGTCCTT
CAGACTCAATGTCAATGTGAGGGCTCTAGAAGAACGGCAA
GTGAGGATGGTGATTCTAGACATCGGCCTGCCTACAGGCT
TTGAACCCGAAAACTCTGATTTAGAGTTGCTCACAAATTC
AGTGGATCGCTACATCAACAACTTCCAAGTGGTGGACAAC
CTGAGCGACAGAGGATCCCTCATAATTCACCTGTTCAAGG
TGTCCAACAAAGAGGCAGAAATGATCTCATTCAGACTCAA
TCAGAAATTTAAAGTGGGGCTCCTTCAGCCTTCCACAGTC
AAAGTTTACCAGTACTACAACAAAGATAAAAGCTGTAGCA
GGTTCTACTCTCCTCCTGAAGACAAACAGCAGCTGGATCA
GATCTGTGAAGGCGACGTGTGCCGCTGCTCGCAGGGAGAC
TGTTGTGTAATGAAGGAAGACTTTGCATTTTTTGGTAAAG
AGCAGAGGAATGCCGCTGTATGCAACGGATTACATCATGC
CTACAGAGTCAAGCTGATCAGTATCAGCCAGAGTCACTAT
TACCAGTATGAGATGGAGATTGTGCAGGTTATCAAAGAAG
GGACGGAGGAAGGTCTGAATGAGAAGGAGAGGAGGATGTT
CCTCTCTCATGCAAGCTGCAGGACCAGGCTTAATTTGAAA
GAGGGTCAGGAGTATCTGGTCATTGGGCCGATCACTGATG
TTTGGAATGCAGGGAGCACAGTGTCCAACAAGTATGTGTA
TACGCTTGGGAAAGAAACGTGGGTTGAGCGCTGGCCAGAT
GAGTCTGAATGTGGATCAACACTGCAGAAGAAATGTGATG
AGCTGAAGAGCTTTGCAAAGAAACTGATTGAAGATGGCTG
TCAGGCTTGAGACTAACTTTTTCTTATGTGTTATTTTGAT
TCTTAAAGTCCACGTGAAACAGAAGTGCTGAGACGTTTAT
TTCAATAGGTTGATGTACTTACAACTAAAACAGAATATTG
AGTAGAGGGCGGGGCTTTCTTTGCGCATCATTCCCTCATA
GCAAACTAACGAGGCTATTAATATAAGCAAATGGTCCGTT
TGGTTGAAGATTACCAAACCAGTTTTTTTCAGTGTATTAA
CTTTATTGACCTTAAAGGTGCAGTAGTTAATTGTCTTCAG
AAGCATTTTTTGTTGTGCTGGCTAAAAGTCTCTTCACAGT
CCAGTAGTAATGATTACAGTAAATGATCTAAATGTGTTTA
TATGTATTGTTATATTCTGAGTAAGGCATAAAACTAAAAA
AAATGTTCATCCAATTAAATATTGTCGGACCGACATCTCC
CATAATTGCGATAAGTAGCTCAATCTTTCTGTCAGCAAAT
GCAGATTTGGGCTTGCCGCCGGCATGAACGCCTCGCTTGC
ATGTCTAGCTGGGCTTGCGCATGCACACAGTCACAGTCAC
AGCGAAATCTAATGCTGAATTGAAACTTTTTAAACTTCTG
AATCATTCCTGAGTTATTTTTGCACGCTGGAGGAAGGACG
ACACCCTGGCTCAAGTATTACTCTTAGCGGGTAATGTTCT
GTTTTAAAACTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations