Transcript

fgf20b-201

ID
ZDB-TSCRIPT-091110-2168
Name
fgf20b-201
Previous Names
  • fgf20b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045512 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045512|OTTDARG00000032562|ZDB-GENE-060117-5 fgf20b|OTTDARP00000035945 fgf20b-001 LG_none CU104718.5,FP015860.6 Danio rerio protein_coding KNOWN, 1289 bp
ATGGCAGCTATGGGAGAGATCGGGACGTTTTTGCAGAGCC
TGGAAGGTTTCGGACAGGTCGGTTCACAGTTCTTCCTGCC
ACCTCTAGGAGAAAACCTCGGACTGTTGAATGATCATTTA
TTTCCAGCAGAGAGACTGTCACGGAGCACCTCCGCAGATC
TCACGCACTTGAAAGGGATCCTGCGGAGAAGACAGTTGTA
CTGCAGGACTGGATTTCACCTTGAAATACTCCCGGATGGC
AGTGTGCAGGGCACCAGAAAGGACCACAGTCGCTTCGGTA
TTTTGGAATTCATAAGCCTTGCAGTTGGGTTAATAAGCAT
CCGTGGAGTGGACAGTGGGCTCTACCTTGGGATGAACGAC
AAGGGAGAACTTTATGGCTCAGAGAAACTCACAGCAGAAT
GTGTTTTCCGTGAGCAGTTTGAGGAGAACTGGTACAACAC
ATACTCTTCTAATCTCTACAAGCATGGAGAAAGAGGAGCG
AGATATTTTGTGGCTCTCAACAAGGATGGGACGCCGCGGG
ATGGGACAAAATCTAGGAGACATCAAAAGTTCACTCACTT
TCTTCCAAGACCTGTGGACCCTGAAAAAGTTCCAGAACTT
TATAAAGAGGTGCTCGGACACAGTTGAGACTTTTCAGGGA
TGAGAAATGTGCGCAGTTTCTTCGCTTCATAAGGAGGTGA
TATGAAAATGTTTGGTCACCGCATCCAAACTGCTCTGGAA
ATGCACTGGCCAGTACTGATGGAGAAGAGATGGTGTCTTT
GTTGCTGGTTCAAACTGACTAGTAGCATGAAACAAAAAAA
GCTGAGACTTTTGGAGGTTTTAAACAAAGTGCTGCTTCGC
TCTGGAAATATTCAATATGGGTTAAGAAGGACTTGAAGGA
ACAATCCTTACGTGATGCTCAGAGATGACAGAACTGGGAC
ACTGGAGAACAAGAGATGCCATCTCACAGGATGTTATTTA
TACAGTTCTTGATACGCATATTTATTGTATGTATTTATTT
ATTTGAAAATACAAATATATATTTTTACATCTAAAAGTAG
ATTGTTGTTTTTTTTATTAGACCAAACGCTAGAAGGTGCT
TTGAAATAGAGGCAAAGCTGTTCTTTTTATATGACGGTTG
CTTGCTATCACTGCTATAATATCAAGGAGGGCAAGATTGT
GATTTCCTTTTGCAAATGTATGAAGAATGCCATGAGACTC
TGTGATTTTTAGATTTGTTTCAAGCTCAAATTCTCAAAAT
GGCATGCTGCACAGTACATTTTACAGGCCATTAAATCAAG
TATTATCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations