ZFIN ID: ZDB-TSCRIPT-091110-2159
Transcript Name: asb13b-201
Previous Names: asb13b-001, ch73-61d6.1-003, ch73-77l8.1-001, si:ch73-77l8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045473 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045473|OTTDARG00000032533|ZDB-GENE-091118-116 asb13b|OTTDARP00000035908 CH73-77L8.1-001 LG_none CU928015.7,CR847826.13 Danio rerio protein_coding NOVEL, 1409 bp
AACTATGGCTGGCGATAATTTAATGGAGCATACATATGTG
AAGCACAAATTCTTCTTTATACTCATATAAATCGGAATAA
GTGATGGAATTTGAAATAACGCGCACAAGGCCTTCGCTTT
TTGGGGATATTGCACATGGTTTGGGCTTCTGGACAGATCG
TTCTGCAGTGCATGAAGCCGCAGCTCAGGGCAGAGTCGTG
CAGCTCCGGAAACTGATCGAGAATGGAGCATCTGTCAACA
TTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTG
TATTCAGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGAT
GCTGGAGCTCATGTTGATGCTCGTAACATTGACGGCAGCA
CTCCGCTGTGTGATGCCTGTGCTGCTGGAAGTCTGGAGTG
TGTGAAGCTGCTGTTAGAGCATGGAGCCACAGTAAATCCT
CCTCTCTTTACCTTCTCACCACTGCATGAGGCCTGCATGG
GCGGTAACTCTAAATGTGTTCAGCTCATGATTGATGAAGG
AGCGCTGATGGAAGCTCATGACTGTCACTTTGGCACTCCT
CTGCATGTAGCGTGTGCACGACAGCATCTGGACTGCGTCA
AGGTCCTGTTGAATGCAGGTGCAAATGTGAATGCTGCTAA
GCTTCATGAGACGGCACTTCATCATGCTGCTAAAGTCAAA
AATCTGGAACTAATTGAGCTTTTGGTTGAATTTGGGGGAA
ATATCTTTGCCAGAGACAACCTTGGAAAAAAGCCAATTCA
GTACACCAGATCCAGTTCAGCGTCCGCCCTCTGCTTAGAG
TTTTACGAATCCACGCCGCTCAGTCTGCAGCAGTTATGCA
GGATTTCTCTCAGAAATGCCCTCGGGAAAAGAGCGCTGGG
GGTTTTCACTCAACTGGGACTCCCAAACCGAATCATCTGG
TTCCTCTCTTATTTACCGGCTCCTCCTATGGAGCTCCTCC
AGTCCTGACGATGTTCTGCTTCGGTCATCTGTGGCGCACA
ACACACTGACTCTGCTTAAGAATAAGGGATTTGGATCATT
GGTTTCCAGGATAAAGGAGATACAGAGACAGTAACAGCTG
TGCTCAGTATTTGTCACGTATTTGCTGATATTTTTTTGCA
CTGTTAGTGCAGGGAACCAACAGACGGTGGTATGAATGCA
GTTTACTGCCAAGATTCCTAAAATAATTTGACTTGGGCAA
AAAAAAAGCACTTTAACAAGTATGAATGGTGTTTTCTGTC
TTACATGGCATTTTTACTGCCGACACTTATAACTGAGTCA
AAACAAGGCAACAGACATGTTGTCTTGCTGTTTATGCAAC
CATAATATTCATAATATTAGCTGTACGATTAAATTTAATC
ATTTGAAGGATTGCTATTTTATATATATATATATATATAT
ATATATATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb13b-201 Contained in:
[BAC] CH73-77L8 (1), CH211-204D2 (1)

Genome Resources: Vega_Trans:OTTDART00000045473 (1),  Ensembl_Trans:ENSDART00000126824 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG575804 (1) 910 nt
GenBank:CK029228 (1) 793 nt
CITATIONS (2)