Transcript

abcc5-202

ID
ZDB-TSCRIPT-091110-2133
Name
abcc5-202
Previous Names
  • abcc5-001
  • ch1073-183g13.2-001
  • ch211-129c2.4-002
  • ottdart00000045351
  • si:ch1073-183g13.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045351 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045351|OTTDARG00000032460|ZDB-GENE-050517-17 abcc5|OTTDARP00000035837 CH1073-183G13.2-001 LG_ FP017147.5 Danio rerio protein_coding NOVEL, 823 bp
GAAGATCTGCAGACCACCAAGAGGAACAGATTTGGTGACT
TTGACAATATAAAGCTCTGAGTTGAAGCAACAAAAGCGCT
CCTATGTTGGTAAAAGAAGATGAAAGGACATGATTTGGGA
AAGGACTGCCTGGCAGCTGGTTCTGCGTACAGAGCCGTAC
CATCCAGAGAGACCTTACCCGGACCTGACGGAGACCATTA
TGAGCTGTCTAAAGTGCAGGATGCTTTTGAAACGGCGGCG
AGAGCTGAAGGCGGACTCTCTTTGGACCGAGGCAATGCCG
CTGACGCTAAAGAGTTGGAGGAGGACGCTGCCGGGAGAAG
CAAATACCACCACAGTGTCTGTGTGCTCAAGCCCATCCGC
TCCACCAGCAAGTATCAGCATCCAGTGGACAACGCCGGCC
TGTTCTCTTTTATGACATTTAACTGGTTGACCTCGCTGGC
CGTGCTGGCCCATAAGAAGGGTCAGCTGTTTTTGGAGGAC
ATATGGGCCGTTTCACAGTTTGAGAGCTGCGAGATCAATC
GTCGAAGGCTGGCGGGACTGTGGGAAGAAGAAATCAGGTC
ACGAGGAGACGACGCGTCTCTTCGTCGTGTGGTCTGGCAT
TTTTGCCGCACGCGTCTGCTGCTGTCCATCCTCTGCCTTA
TGGTTACTCAACTGGCAGGCTTCAGTGGCCCAGTAAGTAA
CACCATCTCAGCTCTGTGTCGTCTTTCTGGTGTCTTTTCT
TCTTCTCCCTCTATCTACCTATCCATCTCTCTCCTACTCT
GTCTTTCTCTATCTCTGTGTATTATTAGCATTGTAGATGC
ACCAATCAAATCCTGCATCCCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations