Transcript

arrb2a-201

ID
ZDB-TSCRIPT-091110-158
Name
arrb2a-201
Previous Names
  • arrb2a-001
  • ch1073-143l10.2-001
  • ottdart00000043135
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043135 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043135|OTTDARG00000031025|ZDB-GENE-030131-29 arrb2a|OTTDARP00000034209 arrb2a-001 LG_ CU469521.4 Danio rerio protein_coding KNOWN, 2008 bp
GGCAGGGCACGTGACCCAACTGTTGCCCCGCCCACCGCCA
GCTACCAGAGAATGATTGAACATCTTCAGGAGTTGCTGTT
TACACTATAGCTGATTGTTTTGCTGCACAATATTTTACGG
CCAAATTCTCCCTCATTATGGGGGACAAGGCAGGCACCCG
GGTGTTCAAGAAGTCCAGTCCCAATTGCAAAGTTACAGTG
TATCTGGGGAAAAGAGATTTTGTGGATCATCTAGATCACG
TGGATCCTGTTGATGGTGTGATCCTGGTCGACCCTGAATA
TCTGAAAGACCGAAAAGTATTCGTGACTTTAACCTGTGCG
TTCCGGTATGGCCGCGAAGACCTTGATGTTCTTGGGCTCT
CCTTCAGAAAAGACCTTTACATCTTCACTTTTCAAGCCTA
TCCTCCCATCCCAGAAGAATCCAAACCTCACAGTCGTCTG
CAGGAGAGACTTTTGAAGAAATTGGGGCAAAATGCTTATC
CTTTCCATTTTTCTATACCACAGAATTTGCCATGTTCTGT
TACCCTGCAGCCTGGCCCCGAGGACACAGGAAAGGCCTGT
GGGGTGGATTTTGAGATCAGGGCTTTTTGTGCCAAATCAA
TGGAAGAGAAGAATCACAAAAGGAATTCAGTTCGACTAGT
GATACGTAAAGTCCAATACGCCCCTGAAAAACCCGGCCCA
CAGCCCATGGTGGAAACGACAAGAAGCTTTCTCATGTCAG
ACCGCTCTTTACATCTAGAGGCTTCACTAGATAAAGAGCT
GTATTACCATGGGGAACCCATCAGTGTTAATGTCCATGTC
ACCAATAACTCCACCAAGACCGTCAAACGGGTCAAAATAT
CAGTTCGACAGTATGCTGATATCTGTCTCTTCAGTACAGC
GCAGTACAAATGTCCGGTGGCTCAGATAGAGGCAGATGAT
CAAGTGGCATCCAGTTCGACGTTTTGTAAAGTGTACACAC
TCACGCCAACTCTCAACAACAATCGCGAGAAAAGAGGACT
GGCGCTAGACGGAAAACTCAAACATGAGGACACCAACCTG
GCATCCAGTACAATTGTGAAAGATGTGAGTAATAAGGAAG
TTCTGGGTGTCCTGGTGTCATATCGGGTTAAAGTCAAACT
GGTGGTCTCCCGTGGAGGGGATGTTTCAGTGGAACTGCCT
TTTGTCTTGATGCATCCAAAACCATCAGAGTCCAGCCTTT
CCCACTCAACCTCAGCTGTGCCAATGTTGGATCCACCAAT
TGACACCAACTTGATAGAGTTCGATACCAACAGTTTAATC
CCTGACGACGACATTGTATTTGAAGACTTTGCTCGATTGA
GGTTGAAAGGAGTTATAGATAAAGAAGAGGATTGCTGAAT
CATCTCAATATTTATCAAATTGTGCATCTTTCATGTCCCC
GAAGGTGTACTAATGAAACGGTTCTTCTCATCCCGATACG
AATGAAGCAGTATTTGGCGATTTTATTGAAAAAAACAAAC
AAACTGTGTATATTGCGTTAAATTCATGTGAAAAGCAAAT
GAAGAAGGGGATACCAGGGAATTTCATACACTTTCTGCAT
AGGCATGTGATGATTATATCTGTCATATTGTGCCAACTGT
TATGTTATGAATGGCGAGCCAGACTATAGAGATGGCTAAA
TTGCTCGGTATTTATATTCCTTTACAGATTTTCCTGTGAT
CTATGTACATGAATAATCCACAGCGATGGACAGTTTCAGT
GTCAGGGCTGTGCATGTTTCTCTGAGCTGCTGTGAAGATC
TTAAGTAATTGAGCGGGTTGTAAATATATGAAAAGTGCTG
CTTTTAATTTGTCAAACTGCTGCATTTGGGTAAAAAAATA
CAATAGCAGGAATTGGATGTATAGAGATTTAACATCCCTC
AGAAGAAAGGAAATTTGTTGTTATTACAACATTCATCATG
ACAGGATACACTGTTTGCCATTTTATTTTTTTGTTTTAAA
ACTGGATTTTTATTTAACTTTTTTTAAATAAAAAAAAACT
AATACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations