Transcript

b9d2-201

ID
ZDB-TSCRIPT-091110-1495
Name
b9d2-201
Previous Names
  • b9d2-001
  • ch211-160d14.5-001
  • ch211-51a20.17-001
  • ottdart00000022203
  • zgc:92713-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022203 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022203|OTTDARG00000018325|ZDB-GENE-040718-90 b9d2|OTTDARP00000018618 CH211-51A20.17-001 LG_ AL929321.12 Danio rerio protein_coding KNOWN, 997 bp
GATGAAGTGTGTTACTAAGGAAGTCCAGCCTTGGTGACAG
GAAGGCGCTGTAAACACTGCACAAAAGCTTACTGGATTAA
CATAATAACACGGTTTACAGTCTTTCCAGTTTCGCCGATC
AATGAATCTATAGCGGCGACTGTGTTCGTTGTGGTACGCG
AGCTTATAGTGACCATTCTGCTTTATCGATGTAGATACTC
TTATGGCAGAATTGCATATCATTGGACAGATCATTGGGGC
CACCGGTTTCCCACAGAACAGCCTTTTCTGCAAATGGGGT
GTTCATACAGGAGGAGCGTGGAGACTTCTCTCTGGTCTGA
GGGAAGGCCAGACTCAAGTCGACATGCCTCAAACTGGCGA
CATGGCATACTGGAGTCATCCCATTGATTTGCACTACACT
ACTAAGGGTCTACAAGGATGGCCAAAGCTTCATCTGCAAG
TGTGGCATCAGGACTCTTTTGGCAGATGCCAGTTGTATGG
TTATGGCTATATCCACGTGCCATCAAGCCCAGGTCAGCAT
CGTCTTCAGTGCGTCACATGGCGGCCACTAGGATCATGGC
AGGATCAGCTTTCGGAGATGTTTGTCGGAGGAGGCCCTCA
GCTGCGCTCACCAGACCTCATCTACAGTGGCGCAGACCGA
TACAGACTGCACACGGTCGGCATGGGCACCGTTGAGCTAG
AGCTCTGCATTATTCTTCGCCACTTTGACAGATACGGTGT
GGAGAGCTGACGGACTGCAGGTTAGGACACATTTCAGAAA
AGGAGGGTGTGGAGTGAAAAAAAAGCTCAAATATTTGGTT
ATATTGGACTAGAGGTACAAAAATGTATATATTGTGTCAT
AGAGTGAATGAAATAGTGAGTTATGGGTTTGTCTGCAGGC
TGAAAATGTGTTGTGCTTTGCGTCTCAAATTATACTTTTG
TATTTTTTGCACACTTTGTATGTTTTCTAGCATTGTATTA
TGATCTGATGCAATTAAATTTGATATTCGTCAATGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations