Transcript

nktr-201

ID
ZDB-TSCRIPT-091110-1241
Name
nktr-201
Previous Names
  • dap1a-003
  • nktr-001
  • ch73-389c16.1-001
  • ottdart00000044482
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044482 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044482|OTTDARG00000031919|ZDB-GENE-030131-1725 nktr|OTTDARP00000035163 CH73-389C16.1-001 LG_none BX571770.6,CU463039.6 Danio rerio protein_coding NOVEL, 4810 bp
AGATCTGGCAACATGAAAAAACCTCAATTGATCAGTCGAC
AGAGCGGGTTTAGCTTTTTTGGAGCTTTTTGACTTTTAAC
TAGCTGTTAAGGAAGCCCACTCTGTGGAAAAAATGGGGGT
GAAAGATCGCCCTCAGTGCTATTTTGACGTGGAAATCAAC
AGAGAACCAGTTGGACGAATTGTCTTTCAACTGTTCTCCG
ATATTTGTCCCAAGACAAGTAAAAATTTCCTTTGCCTGTG
CACTGGCGAGAAAGGCAGTGGCAAAGCTACAGGGAAAAAA
TTATGCTATAAAGGTTCAACTTTCCATCGAGTTGTAAAGA
ACTTCATGATCCAGGGGGGTGATTTTACTGAGGGCAATGG
AAGAGGGGGAGAATCTATATTTGGTGGTTTCTTTGAAGAT
GAGAACTTTACTCTCAAACATGACAGAGCCTTCCTCTTGT
CGATGGCCAACCGTGGCAAAGACACAAATGGCTCCCAGTT
CTTCATAACTACAAAGACAGCGCCTCACCTAGATGGAGTG
CATGTGGTCTTCGGGCTGGTCATCTCTGGCTTTGAGGTCA
TAAAGAACATTGAGGGGCTGAAGACTGACTCAGCCAGCAG
ACCGTATGCTGATGTCAGAGTGATTGACTGTGGACAGCTG
ATTACAAAGTCTGCAAACGACGTTCTTCAAGGCAAACTGA
GAAAAGCATTCTATTCTGAGGATGACTCTCAGAGTTCCTC
TGAGTCTTTATCTGAGCATTCCTCACTAGAAGAAGAGCCT
ACATCTCGAAAGAGGAAAAAAAGCTCAAAGAGTAAACATG
CAAAGAGAAGCAGAAGAGAGGCAAAGAAGGACAGAGAGAC
TGTTAAAACTGCAGGACCCGCAAGTCATGCTGAGGGCGAG
ATGGCAGAGGAAAATGATGGTGAAGCTGAACAGAATGTGA
AAAGGGAGAAGCCTGTGGTCCGACCAGAAGAGATCCCACC
TGTGCCAGAAAACCGTTTCCTGCTCCGCAGAGACATGCCT
ACCCAGGAGGAGGCAATAAAAATTGATGTACAGGACACAG
ACATTGTACCAAATGACACCAAACCAGCTGTCACAAAATC
TGGACGCAAGATCAAAGGCCGCGGAACTATGAGATACCAT
ACACCCCCTCGGTCAAAGTCCCGTTCAGAGTCAGAATGTG
AACGGGGGAGCAGTGAGACTCCCCCACACTGGAAAGAGGA
AATGCAGAGGACCAAGGCTTACCAGCCCCCCAGTGTGGAG
AGATGGAGTAAAGAAGAAAGATGGGATGACAGAAGTGACA
CCCCAAGGTCCAGGTCAGAATCCAGAGAACATTCCTTGGG
TGAGGCCTCTGTGTACTCAAGCCAACATAGATCTAAAAAA
GAAAAAAAGAAAGCCAAACAAAAGAAGAAATCTAAGAAAC
GGAAGCATGCTAAAAAACATAAAAAGACCAAGACCAAGGA
AACATCTCTGACGGATGGTGAGGTGTCTGTGTCCTCAGGT
AAGAGGACAAAACACTCAAGCCGTGCTGAAAGGAGACGTT
CTCGTTCTTATTCTCGCTCATCCTCACGTCACTCACATAG
ATCGTATAAATCGGAGTCAGAAAGGAGACATTACTTATCG
AGCTCTTCTAGAGATTCACGGTCTTATTCGAGATCTAGGA
GCAGATCATATTCTAGAAGTGACTCAAGGTCAGAGAGGCG
GGCTCGATCATCCAAGAGGTCAAGTCGAAGCCGATCAGGG
AGGTCTGTTACACATTCTAGGTCACGGTCTCGTTCTAGAT
ACAGGACAAGGTCAAGAACCAGATCAAACTCTAGGTATAG
TTCAGAAACCCCAACACGTTCCAAGAAAAGAAATGAATTG
AGATCCCCTCGAAAGTCCAAGCCTACAGAGGGTGGTATTT
CCAGATTAGATAAGTCTGTCCCTAAATCGATTAAAGGTGA
AGAAGCTAAAGTTCAACCTTCAGCGTCTTCAGAGAGTGTC
TCTGCATTGCCTATGAGTGACAGTCCACCACCTTCTCGAT
GGAAACCAGGCCTGAAACCCTGGAAACCTTCTTATGTCCG
TATCCCAGACACTGATGTAAAATCAGCTCTGGCTTCCAAT
GCACTAACAAGCTCATCGTCAAATGCACCTCTGGAGACAA
TGTCCTCTTTAAAGCAAGATATAGCTGTTAGTCAAAGGGA
TCCAAGCAGTGGTAACAGTAACATTCCTGATAGGCTCTTG
GAAAGAAGTTTATCCAGGAGCAGGTCTTGTAGTCAATCAG
GAAGCTGCAGCAAATCACCAACTCATTATGGCAATAGATC
GTCCTCCTGCAGTAGGTCAGAATCTTATAGTTCATACAAA
GAAAGATCCACTGTGAAGAAGAGAAAACATTTCAGTTCTC
ATAGAAATGCTCAAAAGAGAGACAACCATGCAAATCGTCA
TGATGGTGGCCACAAAGATACATCTCCCTCCTCAGAGGAT
GTATCAGATAATCCATACAGCCCATTACACGTGCAAAGTG
ACATCTTGGTACAGAAAAACACGCTTGATTCTCTTTCAGC
CCTACGGGCATTGGCATTAAAAAGCAAGAACCTCAATCGA
AGGAAAGAACCATTAATGGACAAGAAAAGTGCATCTGGTT
GGGAAAGTGATGAGGAGAATGCAAGTAAGACTAATACTGC
CAAAGTACACAATCAGCACCTTGTTAAAGATGAAGAACTT
AATGAAATGAAAAAAAGGCAGATTTTGTCTCGTTGTTGGG
AGTCTGAGAGTGACACAGAAATACCAGATAAAACTGCTGT
TGGTGAGGCTAAATATTTGTCTGAGAAAGAGGAGGGAGAG
GCTAGTACAGAATCAGAATATGAATACCCTTTATGGCCAA
ACCTAGGTGCTGAAATGTCTAAGGAGTTAAAAGCTAATGA
CGAGCACTCTGCAGACACAAAACCTTCAAAGCACAAGAAC
AAAAAAGCCAAACGGAAGCACAAACACAAGAGGAAGAATT
CTTCAAGGTCAGCATCTCGTAAATCCAAGGCCAAGAAATC
CAAGAAACATCAGAAGCCAAAAGAGACATTTCATTGGCAG
CCTCCTCTAGAGTTTGGGGACGAAGGTGAGGAGGACGATT
CAGTCACTCAAACCAAGCAATTACACAAAGCAAGTACTGA
TGCCATCAATGATGGAACAAAACGTAATTTAAAGGCTGAA
CAGATCAAGCAAAAAGTCTCAGAGAATACAGATCAGGATC
AAAAGATTGTTGAATCACAGCAAGATAAGTTGTCAATAGA
GTCTTCTAAAGTTATTGATGAGAATGAGAAGATGCCTAAA
ATCCAAAAATCAAAGTTACACAACAATACCAAAAGAGATC
TTGCTCAAAGCCACCCAGAAACCCTTTCCAATCTTTCAGA
CACTAACTTGGCAAGTAACAAACCATCAGACCTGAATAAA
GTTGAGCCACATTCTCCAGAGTGCATACCAGAAGCTCAGC
AACTTGGGCCCAAAGCAACTGGCTTTTCCCCACTGAAAAA
TATTCTAAATAACGACAACGTGCTTGTTCCATCTCAGAAA
GATAAAGTCAGCTCCATTACTACTGGATCAGCTTTACCAC
AAGACAGTAAACAAGAGGAAACTATACCTGGTGACAGTTG
TGTCTCAGTGGTTGAAAATAAATGGAAACCTTTGACAGGG
ATGACGGCTGTGCAAACCATTACGAGAAAGCCTTTCATTA
TGAAAATAAACAAACAGCAAGATCAACTTGTAGGAAAGAG
CCAGGGTGTCAAGATTGAGATCAAGAGCAAGAGTAAAGTT
CGTCCAGGATCCCTTTTTGATGAGGTACGAAAGACTGCTC
GGTTAAATCAAAGACCCAGAAATCAAGACAGCTCAAGTGA
AGAAGACTCCCTTCCAGCTGCAGGAGAAAAGCCTGAAGCC
CATAATCACTCAAGGAGCAAGTCAAAGTCTGTGTCTAGTC
ATAGGTCCCACCGCAGAAGTAGGTCCCATTCATATAGCCA
CCCCAGGAGCAGGTCCAGAAGCTACACCTACTCTTCCAGG
AGCTACAGTAGAAGTAGAAGCAGAAGTAGATACAGTAAAG
GACACTCTCGTTCTCGAAGTAGCACCTACCGAAGTTACCG
TAGCCGCACACACAGTAGGAGTTGCTCTAGGGGTCGGTAT
AGAGGTCGTTACAGATCAAGGTCAGACTCTTACGATAGTT
ATTCTAGCCACAGCCGCAGTCGTAGCAGAAGAAGAGGGCA
TCGGAGAAGCAAAAGCTCTGATCGCAGGTCCAGGTCATAT
CGCTCCTACAGTCGCAGTTCCTCTAGGCGGCGAAGTCATA
GTCGAAGCAGTCGATACAGCTGAGTTTAAGGCATAATGAT
TGGATCAATAGTTTAATTTTTGTATGGTAATTTACATACT
TTCTTGTACACTGACATTATGCTGTATTTTTTTTTTTTAC
ATTTTATGAATGAATGTACATTTGAAAAAAACTTAGTCAC
CACTTTTTATTCTGACACTTTTTCTGTATTCCTAGCAAAG
GGAGCATAGAAACCATCCAACTGTATAGCCAAGGTTATAT
ATAAACAGCTACTTACCTCTTACTTATCTTTGAAACATGA
GAGTTTGTAAAATGTATTTCATGTTTGGAAGGATTGTAAC
ACGCAGCTCTGTTGGTTAACATCAATGGAAAAAGTTTTGA
TTGGACTAAATGAATGTTTTATGTTTAATAGATTGACTTG
TTTTTTTATTATTTTTATTTGTACATAAAATACTCTGAAT
GTATCTAATGCTGCTTATTGATATACTGTTGAATTATAAC
AGACACACCTTGCCAACTGTAAATAAAACAATATTTGTTT
GTGAAATGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations