Transcript

mir2188-001

ID
ZDB-TSCRIPT-091023-8
Name
mir2188-001
Previous Names
  • miR_8 (1)
Transcript Type
miRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Confirmed Targets
Sequence
ZFINNUCL0000000146 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000000146|ZDB-TSCRIPT-091023-8 CuratedMicroRNAMature mir2188-001 miRNA published 21 bp
AAGGTCCAACCTCACATGTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations