Transcript

mir429b-001

ID
ZDB-TSCRIPT-091023-4
Name
mir429b-001
Previous Names
  • miR_4 (1)
Transcript Type
miRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000000140 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000000140|ZDB-TSCRIPT-091023-4 CuratedMicroRNAMature mir429b-001 miRNA published 22 bp
TAATACTGCCTGGTAATGCCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations