Transcript

mir2184-001

ID
ZDB-TSCRIPT-091023-1
Name
mir2184-001
Previous Names
  • miR_1 (1)
Transcript Type
miRNA
Annotation Status
published
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000000136 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000000136|ZDB-TSCRIPT-091023-1 CuratedMicroRNAMature mir2184-001 miRNA published 21 bp
AACAGTAAGAGTTTATGTGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations