Transcript

sgf29-201

ID
ZDB-TSCRIPT-090929-9968
Name
sgf29-201
Previous Names
  • sgf29-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027409 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027409|OTTDARG00000021521|ZDB-GENE-041010-62 sgf29|OTTDARP00000022451 CH211-66P13.4-001 LG_ BX784026.17 Danio rerio protein_coding KNOWN, 1359 bp
TCTGAAGCCTGATGCTCTCCTAAGCTTCTTTCTCAATAGG
GCGTTTGAAAAAAACACTCCATGTGTCCCTTCACAGTGTC
CGTACGAGGCCTAGCTAGTAAGCTAACAAAATATCGGAAA
GCGTAAACAAACGCTTAAAATTCGTTACTCTTTAATAAAT
TAATGCTTTTCGATTGTAGTTCGTGTACTAATACACAAGG
TGAATCTGGAGAGAATCTCGCAGTCGTGTGTTGGAAGGTA
TAATGGCTTTAGTGTCAGCAGACACCAAAATCGCTGAGTT
GCTAAATGAGTTGCATCAGCTCATAAAGCAAACCCAGGAA
GAGCGATCGAGAAGCGAACACAACCTTCTCAACATCCAGA
AAACACATGAAAGGATGCAGACAGAAAATAAAACCTCTCC
ATATTATCGGACTAAATTGAGAGGTCTTTACACCACAGCT
AAAGCAGATGCTGAGGCAGAATGCAGTATACTTCGACGGG
CGCTTGACAAAATTGCTGAAATTAAATCTCTTTTGGAGGA
GAGACGGATTGCTGCGAGAATGGCAGGAGTGTACAGCGAC
AATGACCCACCCAGAAAGACCATGCGCAGAGGAGTCCTGA
TGACCCTTTTACAACAGTCAGCCATGACACTTCCGCTATG
GATCGGCAAACCTGGCGAAAGTCCTCCACCTCTGTGTGGC
GCTATACCTGCAAGCAGCGACTATGTGGCTAAGCAGGGGG
ACAAAGTGGCGGCTCGAGTGAAGGCTGTGGATGGTGACGA
ACAGTGGATTCTTGCTGAAGTTGTCAGCTACAATCACTCC
ACTAACAAGTATGAGGTCGATGATATTGATGAAGAGGGTA
AAGAGAGACACACGTTGAGTCGAAGAAGAATAATTCCTCT
CCCACAGTGGAAAGCAAATCCTGAGACGGACCCAGAGGCC
CTGTTCAGTAAAGATCAGCTGGTTCTGGCTCTCTATCCAC
AGACCACCTGCTTTTACAGAGCTCTGATCCACACACCACC
GCATCGGCCTCAAGATGACTACTCGGTTCTGTTTGAGGAC
ACATCTTATGCTGATGGTTATTCTCCACCTCTTAACGTCG
CCCAGAGATATGTAGTGGCCTGCAAGGAGAACAAGAAGAA
GTGACCGAAATGTACGAAAGCAGGATGTTGTGTTTAGAAA
GAGCCTGCATGATTGGTGTGATTGAATTGAGAGTTTGTTC
TGTTTTAATGTGCATTCGTCTCCTTTTTTTGTTTTGTTAA
CATGTACATATTACTGGGCCGTATATTTTGTACTGCATCT
TTTTCACTCTGTTTTTGTGGATCTAAATGCAAATGAGTTG
TGCTAAAGTAAATAAATCCTGTTCGTTTGAATGAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations