Transcript

ptgdsb.1-201

ID
ZDB-TSCRIPT-090929-9767
Name
ptgdsb.1-201
Previous Names
  • ptgds-001
  • ptgdsb.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027196 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027196|OTTDARG00000021398|ZDB-GENE-030131-8436 ptgdsb|OTTDARP00000022282 ptgds-001 LG_ BX469922.12 Danio rerio protein_coding KNOWN, 1029 bp
CTCCACACACCAGACTCTGCCTTGTGAACTGCAAACAGAG
AGAGAAGCAACACTTCTGCAAACATGACGAGTGTCGTAGT
AAAGATGCTGTGCCTTCTGCTCTGCGCAGTTTTCGCCTCG
GCTGATGTCATGCCCATGACTGACTTCGACCTGCAAAAGG
TGGAAGGAAAGTGGTATCTCGTTGGCTTTGCTACAAACGC
AAAATGGTTTGTCAGTCATAAGGATGACATGAAGATGGGA
ACTGCCATGCTGGTGCCCACCCAGGAGGGAGACCTTGACC
TCAGTTACTCTAACCTGAAGAGTGATGGTTCCTGCTGGAG
GATGACTTACCTCGCCAAGAAAACCGAGACTCCTGGAAGA
TTTGTCTTCTACAGCCAGCGTTGGGGAAATGACAATGACA
TGCGCGTGGTTGACGCCAAGTTTGACGAGTACGCAATTTT
TCACACCATCAAGACCAAAGGAGGAGTATCTGAGATCCTC
AACAAACTCTACAGTCGCACTCCAGAAATGGTCGATGACT
TGAAGGAGAAGTTCAGGCAGTTTTGTTTGGACACTGGCAT
CCTTGAGGAAAACATTGTCATGCTTCCACAAAATGGAGAA
TGCTCAGTTGCCGCATAATCGCCTCATCAAGCGAAGACAA
AGACAGCTTCAGCTGGTCCAATCATTTCAGCCAAAAACAG
ATCTGAATTTACTGTCGGCTTGGTTTTGGTCTCTTTCACT
TTGTATGGAAACATTCTTTGTGCCTTGAACAGTCATGGTG
TGCTCATACTGATTGACCAGTTTGCAACTACAGAGTAATC
AAAAGCAGAGGGGAGAGAATGGCAAAGCATTTCCTTACCA
AAAAGATGTTTTTTGAACTCAAGTTTTTCATGTTCTAGAC
CGATGTGTCATGTTTTTAAGTGCCAATGTTAGCTAACATG
TCTGATCACCCATTTCACACACCACCTGCAGGACTTTTAT
AAGCTGTGCTTTTTATCTTTGATGGTTTTGTTTACTGCTG
ATTGATTAAATTGGTTTACAAAAGTCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations