Transcript

ythdf3-201

ID
ZDB-TSCRIPT-090929-9752
Name
ythdf3-201
Previous Names
  • ythdf3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027181 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027181|OTTDARG00000021390|ZDB-GENE-030131-6123 ythdf3|OTTDARP00000022269 ythdf3-001 LG_ BX649452.4 Danio rerio protein_coding KNOWN, 3099 bp
CAGCGCTCAAACGGAAGTGAGAGTCAGAGCCCATCCGCCA
TTGTGGAGCAGAGCAGGGGTAATATTCTCTCCAGACGTTA
CACAGTGTTGTGAATGTTTCGGACTAACATAAACACCCCA
AACTGCCACCAACCTCCTCCAGCCGTCTGACATTCGCTGT
CACTGCCGTCCGAGAGCACCGCTGCCGACCGTTTGAGAGC
AGGCGAGCAGATCAACGCCTGAGAAATACGCTGTGATTAT
AGGGCAACCCGGAGGGAGGAAAAAAAATAACGTGAACCCG
CAGCGGTGGCAGGAGAGACCGTGGACAGTCATATCAGCAA
TCAGTTTGGGCTCCCGGAGGATGTCTGCGACAACTGTCGA
TCAGAGACCTAAAGGACAAGGAAACAAAGTGCAAAACGGT
TCGATGCATCAGAAGGATGCTGTAAATGATGATGACTTTG
ACAATTACCTGAGCAGTCAGTCAAATCAGAGTAATAGCTA
CCCACCAATGTCTGATCCCTACATGCCCAGCTACTATGCT
CCCTCTATTGGATTCCCTTACTCCCTGGGAGAGGCTGCTT
GGTCCACTGCAGGAGACCCTCCTATGCCTTACCTGACCAC
GTATGGACAGATGAGCAATGGTGAGCATCACTTCATTCCT
GACGGAGTCTTCAGCCAGCCCGGTGCTTTAGGCAACACGC
CCCCCTTTCTCAGTCAACACGGATTTAACTTCTTTCCTGG
AAATGCAGACTTTTCTACCTGGGGCACCAGTGGTTCTCAG
GGACAGTCAACACAGAGTTCAGCGTACAGCAGTAGTTATG
GATACCCGCCAAGCTCTTTGGGCCGGGCCATTGCTGATGG
ACAGGCTGGATTTGGTAGTGACACGCAACTTAGTAAAGTT
CCAGGGCTCAGTAGTATCGATCAGGGAATGGCAGGACTGA
AGCTCGGCTCTGACATGTCAGCTGTTACGAAAACTGTTGG
GTCTCCTTTAGGAGGGACGGTGGGTATGAGTAGCATGGCC
GCTAACAGCATGCCACCTGTCAGCTCCTCTGCACCGAAAC
CCACTTCATGGGCAGCCATCGCGAGGAAACCTGCAAAGCC
TCAGCCTAAGATGAAGCCGAAGCCCAACATGATTTTGGGA
AGCGGCGTCACAATTCCTCCTCCGCCAATAAAGCATAACA
TAAACATTGGGACTTGGGAGGACAAAGGGTCCATCACCAA
ACCCCCTCTTGCGCAGCAGATGCTGCCCCCTCAGCAGTTG
GTACAGCAGCAACTCTTGGCCCAACCTCCACCCATGCTTC
AAAGTCCTTTGCCACCTCAACACCAACCCCAACACCAGCA
GCTCCAGGTCCAATCTCCCCAGCACCCTCAGCATCTTCCC
CCAGGTCCTCCCCACCATCACTCGCAGCCAGGACCTCCAC
AGCCCCTGCACCCATCTCAGGCGCAGAACCCCCTAATCCA
AAACCGCTGGGTGGCCCCTCGGAACCGAGGAACCATGTTT
AACCAGAACAGCGGCATGGATAACTTTGGCCTTGGGACAG
GAGTCCCCATGAGCTCATCGCCTTCCTCCAGCGAGGTTCA
TCCCGTGCTGGAAAAGCTTAAGGCCCTCAACAATTACAAC
CCCAAAGACTTCGACTGGACCTTGAAAAACGGACGGGTCT
TCATCATCAAGAGCTACTCTGAGGACGACATCCACCGCTC
CATCAAGTACTCCATCTGGTGCAGCACAGAGCATGGAAAC
AAGCGCCTGGATGGTGCCTACCGCTCGCTCAGTGCCAAAG
GTCCACTGTACCTGCTCTTTAGTGTCAATGGCAGTGGACA
CTTCTGCGGCGTGGCGGAGATGAAGTCAACCGTGGACTAT
AACGCGTATGCTGGCGTCTGGTCCCAGGATAAATGGAAGG
GCAAGTTTGAGGTGAAATGGATCTTTGTTAAGGACGTGCC
CAATAACCAGCTCCGGCACATCCGCTTAGAAAACAATGAC
AACAAGCCTGTCACCAACTCCAGAGACACTCAGGAAGTGC
CCCTAGAGAAAGCAAAGCAAGTGCTTAAAATTATTGCGAC
TTTCAAGCATACCACCTCAATCTTTGACGATTTTGCACAT
TACGAAAAGCGGCAGGAGGAAGAGGAAGCCATGCGAAGGG
AGCGAAATAGAAATAAGCAGTAGGTTTACAGAGATCTCCT
TGGTAGAACGTCAACACTAATGATGTAGAACCTTAAATAT
TGTGTAACCTCAGAGGAACAACTGGGTTCTGACCTATTTT
TTCTGCTAAAGATGATGTACGAACACTTAAATCACAACAG
TGGACGATTCAGCGTCAACTTCTGATGGATCTGCCCTTAC
GCTCAAGTCTCGCACGAAACGGAAATGAAAATCACTCACG
TAAACTATCTTAAAGCACTTTCAGCCCTTCTAAAAGCTTA
TACCAGTATCCTTAACTATTATTGGACACCTGTTCGGTAT
TAACTGACTAACCAGTGTCATTGGTTCTGAGGATTTCAAA
TGTTTTTGCAGGCTTCTTGTTTTGTCTTTTTGTAAATCAT
TGAAATTTTAGCGCTCTTGAAACTTGAGCACTCTCAGAGG
AGGCGACAATTATGTATCCAAGGACAGAGAAATCATACTT
GAATTTACGTAACGCTGTAAAAACACAATTGATATTTGCC
TGACTGAATATCAAGTCTGAATAATCACGTCCAATATTGT
AGACTGACTCCACAGTAGCCATTTCACCTTTGTGTGTTTG
CATCTTTTTTTTTTTTTTCTTGTGTACCAAAAGATTTCTT
TTGCAGCTTGGTGCAGAATGACACCAGCCAGTGCACACTT
TTTTGTTTTGTTGTTGAATTAATTTGTTTCTTTGTTATTT
TCCTGCAATCTTGTCATTCAGAAGTGCATTTGTCTTGGGA
GAAACCTGCTCAGAAATGCCATAAGTTCCTCTGACGTCCA
TCAATCCTCAAATCTGGTGTTCAGGAGAACCTCTTTAATG
CTTTTTTTTGGGACTGATCAGGATTCTAATCTGCTGCTAA
ACAGAATTCAGTCTGAATTGCCGAAGCTCAGTGAGAACGT
GACAGTTTTCTCCTATAGGTGACTCACTAGCTAAAATAAA
CATTATCCATGTTTAGCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations