Transcript

mbtps2-201

ID
ZDB-TSCRIPT-090929-9749
Name
mbtps2-201
Previous Names
  • mbtps2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027177 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027177|OTTDARG00000021386|ZDB-GENE-030131-6598 mbtps2|OTTDARP00000022266 mbtps2-001 LG_ BX537285.6 Danio rerio protein_coding KNOWN, 3026 bp
ACACGCGGAAGCGACGGCTTCCACTGGTGTTTTGTACACA
GTGGATGTGCAGAGCCGTGCTGGACAATTGAAATTGCCCT
GGAATTGGTGTGTGTTTTAGACGCATGCAGCCCGGTGTGC
CATGATCCCCATAGCGGTGGTGGTGTGTGTGATGGGCGGC
TGGTGTACCGTGTATCTGGCGGATACGCTGCTGCGGTCAT
CCAGTTCGGTAAAGAACCGCTATGAATCATGGTTATCCTC
GAATGGATTCACACTATCTCCCTTCCATATCAAGTGGCAC
ACGGGCATCTTCAACCGTCTGTTTGCCAGATGTGCTCATT
TCAACCCTCACTTTCTCTACATCTGGTTCAGTGCTGGTAT
GGTGTTCGGGGTTTTGGCGATGTTTGGCTCAGTTGTTCTC
CTGAGCAAAACATTACTGCAGACTCTGCATCAGATGATGG
CAGACACACCGGACGGGTCCCACGAACAGGTTTTGCAAGT
GGTGGTGCCTGGTGTAAATCTTCCTGTCAGTCAACTGGCC
TATTTTTTCATCGCTATCTTGGTCAGTGGAGTCATACATG
AGTTTGGCCATGGGGTGGCAGCACTGAGGGAGCAGGTGAG
GCTGAATGGTTTTGGCATGTTCATGTTTGTGATTTATCCC
GGAGCGTTTGTGGATCTCTTCACCACACATCTGAACCTCA
TCTCTCCAGTCCAGCAGCTCAGAATATTCTGCGCTGGAGT
CTGGCACAACTTCATGCTGTGTGTTGTGGCTCTCAGCTTC
CTGTTCTTGCTGCCCATCTTTCTGTTTCCCTTCTATTACA
CCGGAGCAGGAGCGCTGGTCACTGAAGTGGTGGAGGGTTC
TCCCTCGAGTGGACCTCGTGGGCTATTTTTAGGTGATCTG
ATCACACAGCTGGAAGACTGTACAGTTCGGGGTGTACAGG
ACTGGCACAGCTGCGTTCAGCATCTATCCCATAATCCTCA
GACAGGCTACTGCGTCCACACTGCCAAACTCCATCTCAGC
TACACGCAAGGAAGAGCATTCAAGCGTCTGGATGGCACTA
TGGAGTGCTGTGGGAACAACAGCTTGACAGACCTCTGCTT
CTCTTACAGTAACAACGTGGAGAGCAAATTATTTGCCTGC
CTGCCGGTGAGAAAGACCATTGAAGCGAGTCGTACATGTC
ACACCAACACAGACTGTCAAACAGACTTCACCCCAAGCTT
GTGTTTAATCCCTTCTCTGGAGAACCAGACCCGATTGATC
CGGGTCAAACATCCTCCACAAACAGACATGCTCTTTGTCG
GATACTCTTCACACCTACAGTATTCAGTGAGTCTAACCAA
TTTTGTTCCTCGGCTGGGCTTTCTTCATCCAGACTTGCCT
GTCATGCTGGAAACCTTCTGCAAATACCTGGTCTCACTGT
CCGGGGCTCTTGCAGTGGTAAATGCAGTTCCATGTTTCGC
TCTGGACGGTCAATGGATGCTCACAGCCTTCCTCGAAGCC
ACGCTGAGCTCCGTTATCCAGGAGAGGAACAACCGAGAGC
TGATCGGCTTCTTTTTTCTACTGGGAGGCAGTGCTCTTCT
AGCAGCAAATGTGGCTCTGGGCCTGTGGATGGTCACGGCA
CGGTAACACACACCCATCTCCTCCAATCAGACGGTTTGGG
GGAAATGTTGATTCAATATCCTTCTTGAACTGATGGAGGA
AACCACTGGGTTGTTTTACCTTTGCTGGTTATTGTCAGGC
TGTAGAACCAAAGGGTTTAGATCGTTGCTTTATCCGAGAA
CACTGGTGATCTTGGTTTGATTGGCTTGAATAGAAACAAG
CGGTAAAGAAGATCTTGAAGCTGTGTGCTTTTGCAATGTG
ACCTCAGGACAGCACCAATAGTGCCGTATCTGATCAATAT
GTGATCACATTGTGTCTGATTCATCATGCAAACCCACAAA
TGAAGCTTTAATAACAAATACATGATGGATTTTGAAGGCA
TTAAATGCCTGTTTGGCCTTTTTGTCTTCCTTATACATAT
GATATCCGTAGGTTTAAAGGTGTAGTTCACCTCAAAATGA
AATTTATTCGCTATTTACTCATCCTCAAGTGGTTATAAAC
CTTTATGAGTAACTTTCTTCTGTTGAACACTATAGAAGAT
ATTTTAAGAAAGCTGAAAACCTGTAACCATTGACATCCGT
AGTAGGAAAAACATATACTATGGAAGTCAATGGATAGAGG
TTTCCAGCTTTCTTCAACATGTCTTAATTTCTGTTCAAAG
GGAGAAGAAGCTCAGATACGATTGGAACAAGCAAAGTAAA
AAATAACAGAAATTAAAAAAAAAAAAAAACTGAGTAAATA
TTGACAGAATTTTCATTTTTGGGTGAAGTATCCTCTTTTA
GTTTTAAATTGAAAAGTTCGTCAATACTCATGTCACTTCA
ACCCAAACCTTAACATCTGTACTTTAAAAATAAAAACAAT
TACTTTATTTACCTCAGTAGGGAAGTTTAGGAATTAAAAA
CAAACATGTTGTCATTTGAAAAAAAATTTAGTCTTGAAGT
AACCTTAAAAAATGTACATTTAGTCCACATGACCAGCCAA
ACCGACTGAAATTTATTTAATGTAAAAAAAAAAAAACAAG
AATTAAAATGTACATATAGCGAATGGACACATATAGCATG
AAAACGGCACAAATAAACAAACTACTGCAGTGATTTGAGC
TTTGGGGAGTAGCTTTAGTGGGTTAGCCAGAGATTTAATG
GCTGATTGTTAATTTTACCAGAGGTATATGCGCTGAAACA
ACTGTTAACTGTGAAGATGTTCTCGTATACAACATACCAA
AAGAAACATTCGCTAAAATACGCTTGGGAAGCATTCATAT
TGTTTATGATCTGTATACTGTGAAATATTTTACCCAACAA
CAATTAGCCAGACTGTGGGTTAGAGCTGCACTAAACTAGG
AATTATTACTTGTTATCACACACACATTCTCTTGCTCTTT
TAATTTGTTGTCTTTATCATCCTACCTGGCCTGTTGTAAA
TATGTTTATAAAAGTCATTTACATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations