Transcript

rrs1-201

ID
ZDB-TSCRIPT-090929-9697
Name
rrs1-201
Previous Names
  • rrs1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027117 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027117|OTTDARG00000021350|ZDB-GENE-030131-9345 rrs1|OTTDARP00000022223 rrs1-001 LG_ BX470095.12 Danio rerio protein_coding KNOWN, 2129 bp
AGAACCAAAATGGCTTCGTGCAGTATTGAAGACGTGCTCG
CTAAAGCTGAAAGAGACGAGGCTGAGAAGCTCAAAAGTAT
TACGGTGCTCAAAGAGTTGGATCTTGAATTCGACCCGGGA
CTTTTGCTGGCGTTTGACAAGAACCGACTTGACACACGGG
ACTTTAAAGGCAACAAACGGGAGGACTGTCTTCGCTCTTT
AGCGCGAGACAACACACAACTTCTCATCAACGAGATATGG
AAACTACCCACAGAGAGAGTCGACGAAGTGATCGTCGCCA
AGCTGCCAGAACCGACCACTAAACTACCCAGAGAAAAACC
AGCACCGAAACCTAAGCCTCCTACTAAATGGGAACAGTTT
GCCAAGCTGAAAGGCATTCAGAAGAAAAAGAAGACCAACT
TGGTCTGGGATGAAGTTCACAAGGAGTGGAAGAGGAGATG
GGGGTATAAACGTGCCAAAGATGACACCAAAGAGTGGTTG
ATTGAGGTCCCGGCGACTGCAGATCCAAACGAAGACCAGT
TCGCCAAAAGGAATAAAGCCAAAAAGGAAAGAGTGGCCAG
AAACGAGTACAACAGACTCAAAAACATCGCCAGAGCTCAG
AAGGTCAAGGTTCCTGGAACAGGACTCCTGCCTACATCCC
AGCAGACCAAAGCGGAGCTGGCACAAGCGGTCAGTCTGGC
CAAAATATCCACCGCATCGGTTGGCAAATTCCAGGAGAAG
CTGCCCAAGGAAAAACCAGCCAGAAACACTGGGAAGAAGA
GGAAATTCCAGCCTCTTATTGGGGACTTCAGTAGCGAGAA
GCAAAAACAGCTGGATTTATTGAAGGTGATGGACAGTAAG
AAGCCCCGTCTCGATATCACTAAAGCTGTGAATAAGCAGA
TGAGGGAAGAGGACTCGGAGTCTGCTCGGAATAATAAGAA
AGGGTTTGGAAAGAAGGGACGCAAGGGAGGCATGCCTGGT
AAAGGAAAAGGCAAAGGAAAACCTGGAGGAAAGGGAAAAG
CTCCTAAAGGCAAAGGGCGCAAACCTCAGATGAAGCAAGG
AAAGCGCTAACATTTAAAGCAGTGTGGTGGACTTATGATG
TTTATTGTAGAATATAATAAATATTGCACACGACTCAACT
TCTCTTAAGTCATGACTTTGAGTGCCTTGCGGCTGGAGTT
TGATTCAGTACAGGAATCGGGTTTGTTTATGTGTTTAGGC
TTTATCTACATATGTCATGGATTAAGATCATTGAACCGTT
TTCATAAATGTCATCTAATATTGACTCCTGTTATTCATTC
GTAATTGTGTTTTCACATTAAATTAAAATTCTTTCTGATT
TGCCATCAGTTCCTGGTTGGATATTGTGAATAATGAGGTT
ATATTTCATCCCCAAAGTTATTTAAAAATGAGTATAAATG
TGTCAAAGCCTGCTGTTAATGGGTAACATTTGTACTTAAA
TAGTATGTTCTTATAATGTAATATAAAATATCATCAAATG
TGTATTTTAGAATTATAAAGCTAAAATATCACCTTAAAAA
ATTGAAGCTAAGATTCAATTAATAAAGTATTTGAGCAATT
TTAATGAAAAGAATATGATTAGATTTATCTTATACCATCA
AATAGAGGAGACATCCCATTTCAGTGTCTACCTAAGTTCA
CAAATGTGATTTTTAATTACAGCAATCAAATTAAATCTAA
TTAAATTGTTTAGTGATTTAAATAACTTTTGTGAAATTAA
AAATATGAGTTAAAAACGCTGTATTGTCATTTAGTGTTAT
GTGAAAATGAAACCTACTGTTATTCTGATCTGTGATGTGA
CAAATATGTATAAAATAATAACTTAAAGCTTTCCCAGAGA
TGGGTTGCAGCTGGAAGGGCATCCACTGCATAAAACATAA
ACTGGAAAAGATGGCAGTTCATTCTGCTGTGGCGACCCCG
GATTAATAAAGGGACTAAGCCGAAAATAAAATACATAATT
TTTAAAGCTTAAATACGTATTGAATTAGAAAAATCTTGCT
GTTAATGGGTAAAATCTGCACTTTAATAGAATGTTCATAT
AATTTAATATAAAGTATAATCCAATTAATACTCATGTAAG
TGTGTTTTCTTGAATTATGAAACTAAAATATTCAAATTAA
AAAAATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations