Transcript

gpr182-201

ID
ZDB-TSCRIPT-090929-9585
Name
gpr182-201
Previous Names
  • gpr182-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026995 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026995|OTTDARG00000021272|ZDB-GENE-030131-2361 gpr182|OTTDARP00000022126 admr-001 LG_ BX321896.13 Danio rerio protein_coding KNOWN, 1481 bp
AGATCCCACGAAACTATTCAGCCGAGCAAATACTCCAGTG
ATATTATTCAGGACAGTTTCTGTAGACGGGGTTAACCCTG
AGTGCCTCATCTGCCAGAACCACAGAACAAGAACATGACG
CATGATATTCACAACTCATCTTTCGACTTCTACAACGGCA
CACCATGGTTCGTCTACGACTGCACCATTCACTTAGATGC
GGATGGCCGGCGAATCGCTCTTTTCCTTCTTTACCTAGGC
CTGTTCATGGTGGGACTGGCAGAGAACACCATTGTAGTGT
GGGTAAACTGGAAAAGACGGCATTCAGCGAATGGGGTGCT
GTTCTGCATCATCAACGTGAGCTTGTCTGATTTGATGGTG
ATCTTCACCATGCCGTTCTTCATGCTGGAGGTGACCATGG
ACAAGGTCTGGCTGTGGGGACGCTTTCTTTGCAAGGTCAC
ACACCTTGTGTATGTTATCAACTTCTACAGTAGCTCCTTC
TTCCTGGCCTTCATGACCCTGGAGAGATACCTGTCCCTGA
CAAGGCCCAACACTCTTGCCTGCTTCCCACAGCAGCACAA
ACGCCGCTGGTTGCTCTGCGCCGGGATCTGGCTCCTTTCT
CTCTTGCTGGCCTTGCTTGAGAACGTCCATGTTGACCTGT
TGGAGTGGGATGAACCGGGTTGCTACATGGTTCCTGAGCA
GTACCACACAGAATGGTTTCTGTCCGTTTCCTTCCTATGC
CTGATTTTCCAGTTTCTGGCTCCAGCGTCTGTCATTATAA
CCTGCAACTTCTTGATCGCCAGAGCCGTCCGCACTGCTCC
AGAGGTCCAGAATCGTCGGGATGTCTGGTTGGTACATGTG
TACTCACTGGTCTTTGTGGTCTGCTGGCTACCCTACCATT
TGGTGTTGTTCTTGTTGACAGTGGATGATATGGACCCACA
TCTGTTCTCCTGCAATACGGTTGGGGTGCTGTACTATTCG
TTTAGCCTTGTGCAATGCTTGTCGCTCTTTCATTGCATCG
CCAACCCAATCCTCTACAACTTCCTCAGCCAGAGCTTCCG
CAACAATTTAATAAACGCAGTGATCAGCCGCATCTCTTTA
TCTCCTGCCAGTGCACCTGCGAATGCAGAAGCCGACAACA
AAGGAACAACAGCAGTAAAAGAGAGGAAGCTCAGTAACGC
TAGCACAAGTCACTCTGACATTGGCGCATGAACTATTAAG
TGACGATGAAGGAAGTTGCTATGAAAAAAAGTGGCCTTGT
TAAGGTGCTTGCAATTGGTCAGTTGCCTGGTAACTAGCCA
TATTTTCTCCTGTTTTTCTCACCTCAGCATTGCAAACAGT
GCAAGGAAGGAAATATCGCCAACCTTTTGTAACCTCTATT
TCCTCTAGTTCCTATTGACACATCTAGGAACTCCAGGATA
ATAAAAGCTCTATCCACATGCCAGTGTTTGTACAACTGTT
TTTTTTTTTTTTTTGTTCGTTCACTTCAACAACAACTTTC
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations