Transcript

prkcbp1l-201

ID
ZDB-TSCRIPT-090929-9479
Name
prkcbp1l-201
Previous Names
  • prkcbp1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026884 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026884|OTTDARG00000021216|ZDB-GENE-030131-2199 prkcbp1l|OTTDARP00000022039 prkcbp1l-001 LG_ BX324190.13 Danio rerio protein_coding KNOWN, 4696 bp
ACATTCACAGCTGCCTTTCTCTTTATTTGGTCTGTTTGCG
AGGACCTCTGCTTGTCTCAGATCGTTCTAGAAGATCTGGT
TTCGGAGGCAGGTTTGCTTGCAGATTGGTGCTTTTCTTCC
TCTTCACCGGATCAGCCTCAGGACTTCCTGTTTCTTTGAT
TTCTGTGTAGGGATCTGGATTTTTCAGCCACACAGTTGGC
TTGACCTTTCCGAAGCCAAAAGGAAAAGGGAGGCCTAGTG
GATGGGAGTTTCTGACGTGACTTGGCCCTAATGTGAAACT
ACATCCATGCGGCTCCTTTCGGCCTCGCATTAAACTCCAA
AATGGAGAGCTCTCAGGCCCTTGGGTACACACTTAGATGT
GCGTTTCTTTCTCAGACATCTTATGTCTAATTCAGATTTT
CTGAAGCGGATAGTCTTTCTCCTAATGTCATTGCTGTCGT
TTCTGACTCAATCTGCTGATTACTTATGACTTTTCTTTTT
TTCTTTTTTTGCTGGAATATTTTCTTGTGAAAAAGTTCGG
CTGTGGAGGAAGTAAAGACGGAGTCCGATGCTGTTGACGG
GATGGAGGTGTCCGTGCCACCCAAAGCCGTCTCTGATGTA
GAGTCAACAGAGAAGAAGAGAAAAGCACCAAGTCCTCCAC
ATTCCTCAAATGGACACTCTCCCTCCGACACGTCACCCAG
TCCCACAAAGAAGAAGAAGAAACCAGGATTAGTCAACAGC
AATAAAGATCAATGTGAGCTCAGACATGGTCCCTTTTACT
ATGTCAAGCAGCCCGCACTCACCACAGACCCTGTTGATGT
TGTACCGCAGGACGGAAGGAATGACTTCTACTGCTGGGTG
TGCCACCGCGAGGGCCAGGTGCTCTGCTGTGAGCTCTGCC
CGCGCGTCTACCACGCCAAGTGCCTCAAACTGGCCGCTGA
GCCGGAGGGTGACTGGTTCTGTCCAGAGTGCGAGAAAATA
ACAGTGGCTGAATGCATTGAAACTCAGAGTAAAGCAATGA
CCATGCTGAATCTGGAGCAGCTGTCCTACCTGCTGAAGTT
TGCACTGCAGAAGATGAAACAGCCAGGGACCGAACCATTT
CAGAAGCCAGTGTCACTGGATCAGCACCCGGATTATGCCG
AGTATATATTTCACCCCATGGATCTGAGCACTCTTGAGAA
GAATATCAAGAAGAAAATGTACGGTTGCACAGAAGCATTT
CTGGCCGACGTGAAGTGGATTCTACACAACTGTATCATTT
ATAATGGAGGGAACCACAAGCTGACCGCAACTGCTAAAGT
TATTGTCAAGATCTGTGAACACGAAATGAACGAAATCGAG
GTTTGTCCGGAGTGTTACTTGTCCGCCTGTCAGAAGAGGG
ACAACTGGTTCTGTGAACCTTGTTCTCAGCCTCATCCTCT
GGTGTGGGCCAAACTGAAAGGTTTTCCCTTTTGGCCTGCT
AAAGCCCTGAGGGACAAGGATGGACAGGTGGATGCACGTT
TTTTTGGCCAGCATGACAGAGCCTGGGTGCCAATCAACAA
CTGTTACCTCATGTCTAAGGAGATCCCCTTCTCCGTGAAG
AAGACCAAAAGCATTTTCAACAGCGCCATGCAAGAAATGG
AGGTCTATGTGGAAAATGTGCGCAAGAAGTATGGCGTGTT
CAACTATGCCCCATTCCGAACGGCTTACACACCCAACAAC
CTGTTCCAGATGCTTCAGGACCCTAATAACCCTAAAAAAG
GCACAGTGAAGTCTGAAAAACAGGACAAAGTCAAATTCAA
CTTTGACATGACGGCATCCCCCAAGATGCTCCTCGGTAAG
TCAGTGATGTCAGGAGGAGGGGGATGTCGGATCTCTGTGA
CGGACATGCCCAGGTCACCAATGAGCACCAATTCTTCAGT
TCACACCGGGTCAGACTTGGAGCAGGACGAACGGGGGGCG
AAAATGTCGTCAAGTCACTGCAGCGCTGGTGAAGACTCAA
TGGATTGTACAGCGTCTCCTGCATCTCTGAAGACAAGCGG
CAGCCCTAAGCCTTTGCTAACTACACCGGTCAAACAGGAG
AGGAGCTCGGGCACAGGAGGAATCCTTAACCTCAATTTGG
ATCGTGTTAAGGCTGAAATGGACCTGAAGGAGTTGAGCGA
GGCTGTACAACAACAGCAACAGCAGCAGCAACAAGGGGCA
TCAGTTCTCCTCACCTCCCCCAAAAAACCTACCAGAAGTT
TGGATAAAACTATAGAGAGCTGCAAGGCCCAGCTGGGAAT
CAATGAGATCTCAGATGACATGTGTGGCGGCGTCGAGCAC
TCTGACTCGGAAGACTCTGATAAATGTGACTCCAGCGACA
GTGAAGAAATGTCTGATGACGAGCAGAAACCCAAAAACAC
TAACCACAACAACAGCGTCCACAAAGACTCAAAAAAGAGA
CCCAGAACTCTGTCCACTCAAGGACAAGACCAAGACTCAT
CAACCACTGGAGGAGCATCAGGTGGGGAGAAGAAAACCTC
GGATCCCCAGACCAAAGAGAAGTCAAGCGGTGGTGCAGAG
AAAGACTCTCAGGAGAAGAGCAAACCTCAACCACAGAGCA
AGAAGGAGAAGACAAAGTCTGCGAAGGACGTCCGGACGGC
TGGCTCAGAGCCAGATTTGGACTCAGACTCTGAGCGCGAG
CTGGTAATCGACCTTGGGGAAGAACAAGGCGGGAGGGAGA
AGAAGAAAGCCAAGAGAGACGCTCCAACGGCCCCCGTTTC
GACACCGAAAGATCAGACGGTTGTTAAAACCGATGGCAAA
TCTTCTACTTCTACCAGCGTTTCAGCTTCTCCTTCTACGG
ATACCACTTCATCTTCATCCTCCAATCCTGCTCCAAAAGA
CGCAGCATCATCAGCCATCAAGCCTCCAGCTGCAGTCCCA
GCTCCATCTACCACTCAAAGCAGCTCTTCCTCTGCTGCTC
AACCGGTGTCCACCGTCCCATCCACTGCCAGTGTTGTGAA
GAAACAGCGCCCTCTGCTGCCCAAGGAGAGCACGCAACCT
GCCCAGCGGCCTGCCACCTGGAGCCCTGCTGCTGGGAAAT
GGCATGTGCAAAAGGTGCAGAAACAGCAGCAGCCGCAGCA
AAGTGAGACTGTTCCTCAGACAGCAACGCAGAGCCAAACA
CAGTCCCAGAGCTCAGCCAACAACAACAGCAGCAGCAGCA
CGCGCTACCAGACCAGACAATCAGTCAAAGTTCATCAGAA
GGACAGCTCACCTGCTAACACGGGGTCCGGATCGTCCATT
TCCAGTCTAGCTGGAGATTTCCTCACCCCTCCGGCCTCTG
CTGATGTCGCTGCCGACATCGCCAAGTACACCACTAAAAT
GATGGACGTGATCAAGGGAACAATGACAGAGATCTACAAC
GATCTTTCTAAGAGCACGACGGGAAACACCATTGCAGAGA
TCCGGCGGTTGCGGATCGAGATTGAGAAACTGCAGTGGCT
TCATCAGCAGGAGCTGTCAGAAATGAAGCACAACCTGGAG
CTGACCATGGCTGAAATGAGGCAGAGTCTGGAGCAGGAGA
GAGAGCGTCTGGTGTCCGAGGTGAAGAAACAGATGGAGCT
GGAGAAACAGCAGGCCGTGGATGAGACCAAGAAAAAGCAG
TGGTGTGCAAACTGTAAGAAAGAGGCCATTTTCTACTGTT
GCTGGAACACGAGTTACTGCGATTACCCCTGCCAGCAGGC
ACACTGGCCCGAACACATGAAGTCCTGCACACAGTCAGCC
ACATCGTCTCAGCAGGAAACTGAAGCAGAAGCCAGTTCAG
ATGCAGCCGGAAAACCTGTAGGACAGTCCCCAAAAACCCA
ACCACCACCATCTGCCGAAAAAACATCGCCCGCAAACCGA
GGACCTTCCCCTTCCACAGACAACACTAAAAGCAGCTCCT
CGGTTGCGGTCTCATAACCCGAGCTCAAGATGTTGTTATT
TTTTATCTTCAGAACGGTGCCATTCAAAGAGAGTCAGATG
TGAACACCAAAGGACCTTGACTCATTTCAGACAGACTGTA
TCATGTTCACTTTCTGTTCACTACATCAAACTCCACATTA
GGATAACGCCTATAAAAGTTTGAGTCATTTCCACGTACAT
TTCGTATTTGAATTTGTGACTTGTTTAGTACAAAGACGCA
CCCTTTGATATACATTATGCAACTGTAAAACTGTTGTCCT
TTTTTTTTATACATATCAGCTTTTGTAAACGTCGACAAAT
GTGTTTGATTGATATCATTTTTTTCTCTTTATGTGAAAGA
TGCACTTAGAAGTGCCTCGGGAAGAGCGAGTTTATTTCAT
ACAAAGGTAAATGTTAAACAGAGCGTGTTTGTACAAGGTC
AAAAACGTTGGGAGTATGATTGTGATTTCTAATGGATTGT
CACTACGTTTCTTGGAAAGATTCAAGGATGTATATCTTTA
ATGTCTTTCACCCATGAAAGGTTTCTTCATGAAGAAACAA
AAGGAGCAAAAATCTAGAGGAGTAAAGGAAAAGATTTTAC
TTATTGTGGGCATGTTTCTTTTTTCCTCTTGTCTTGTGGA
CTCTCTTGTTTACATACTGTAAATACAAAAGAATAAGCAG
AGATGATATCTGTATGAAAAAATAAAGTCTTCATGAGGCA
AACCTTTGGCGTTTCATGCATTGTCTGTTCTTTCTGCATT
TTCTAATTAAACAGGGTCGTTATACCACTAACTGTACTCA
AAAAACAAATAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations