ZFIN ID: ZDB-TSCRIPT-090929-9468
Transcript Name: ralaa-202
Previous Names: rala-002, ralaa-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026872 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026872|OTTDARG00000021207|ZDB-GENE-040426-1344 ralaa|OTTDARP00000022029 rala-002 LG_ BX005461.9 Danio rerio protein_coding KNOWN, 638 bp
TCGGGATCCTCATCAGCTCCACACCCGTGATCTGTGAGCT
TCTGCCGCCGACACACCGAAGATCACGGCGATCCCAGACG
GAAGTGCAGTCTGAGGGCAGCGAGGCCGGTTCCGGTGGCG
TTTTTCGGGATGCAGTGACAGGAATCTCAGCTTCCCGGGA
GTCCTTGTGTTTCTGGATTACCTTTAGCTGAACGAGCAGA
CACAAAGTCCTGCTCGATCTCCTGTTATCATGGCGGCAGC
GAAGCCCAAAGGGCAGAACTCGCTGGCTCTCCACAAGGTG
ATCATGGTGGGCAGTGGCGGTGTGGGAAAATCTGCTCTGA
CACTGCAGTTCATGTATGATGAGTTTGTGGAGGACTACGA
GCCCACGAAAGCAGACAGCTACAGGAAAAAGGTGGTTCTG
GATGGAGAGGAGGTTCAGATAGATATCCTGGACACGGCCG
GACAGGAGGATTACGCTGCGATTCGGGATAATTATTTCCG
CAGCGGGGAGGGATTCCTCTGCGTTTTCTCCATCACTGAA
CTAGAGTCTTTTGCAGCAACTGCGGATTTCAGAGAGCAGA
TCCTGCGGGTGAAGGAAGATGAAAACGTGCCCTTTCTTTT
GGTGGGAAATAAATCTGACCTGGAGGACAGAAGACAAG

ralaa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ralaa-201 (1) 5261
ralaa-202 638
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ralaa-202 Contained in:
OTHER ralaa-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026872 (1)
  • Ensembl_Trans:ENSDART00000147508 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN766465 (1) 640bp
    CITATIONS (2)