Community Action Needed: Please respond to the NIH RFI
Transcript

poc1b-201

ID
ZDB-TSCRIPT-090929-9451
Name
poc1b-201
Previous Names
  • poc1b-001
  • wdr51b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026848 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026848|OTTDARG00000021196|ZDB-GENE-031118-54 poc1b|OTTDARP00000022008 wdr51b-001 LG_none CR405685.8,CT033837.10 Danio rerio protein_coding KNOWN, 2450 bp
AAAAACGCGGTTGGTTTGACAGAAGGGAAGTGGCTCAACA
TGGAGGAGTTTAACTTGTTTACTTGTAAAAAGAAGCACAA
ATTGTCCACGTTTCATACACTTTCTTGAAGTTTACCGGAA
TCATGGCGTCTGTAATGGAGGATCCCACCCTTGAGAGGCA
TTTTAAAGGTCATAAAGATGTAATTTCCTGCGCTGACTTC
AACCCCAATAATAAACAGCTTGCTACTGGATCCTGTGATA
AAAGCCTTATGATTTGGAACCTCGCTCCTAAAGCCCGGGC
TTTCAGGTTTGTGGGTCACACAGATGTCATTACAGGCGTT
AATTTTGCTCCAAGCGGTTCATTGGTGGCATCTTCATCCA
GAGATCAAACAGTTCGATTGTGGACACCCAGTATAAAGGG
TGAATCGACTGTGTTCAAAGCCCACACAGCAAGCGTTCGA
AGCGTTCATTTCTCCAGAGATGGCCAAAGGCTGGTCACGG
CCTCAGATGACAAGTCTGTGAAAGTATGGGGTGTTGAACG
GAAAAAATTCCTCTACTCTCTCAACCGGCACACCAACTGG
GTGCGCTGTGCGAGGTTTTCACCAGATGGTCGTCTCATTG
CTTCCTGTGGTGACGACAGGACGGTTCGCCTCTGGGATAC
ATCCTCACATCAGTGCATCAACATTTTCACAGACTATGGA
GGGTCTGCCACATTTGTAGACTTCAACTCCAGTGGCACGT
GCATTGCATCATCAGGTGCAGACAACACAATAAAAATCTG
GGATATTCGTACAAACAAGTTAATACAACATTACAAAGTC
CATAATGCAGGAGTCAACTGCTTTTCCTTCCATCCCTCTG
GAAACTATCTGATCAGTGGTTCGAGTGACAGTACAATTAA
GATCTTGGACCTGCTGGAGGGGAGGCTCATCTACACTCTT
CATGGCCATAAGGGTCCAGTTTTGACCGTGACGTTTTCTC
GAGATGGAGATCTGTTTGCATCAGGAGGTGCAGACTCTCA
GGTTCTGATGTGGAAGACCAACTTTGATTCGCTGAACTAC
AGAGAACTGTTGAGCAAACACAGCAAACGCGTGACTCCAG
ATCCTCCTCCACACCTGATGGACATTTACCCTCGATCACA
TCACCGACACCACCCTCAGAACGGCACAGTAGAGATTAAT
CCTGTTGCTGATACACAGTCTACTGACCCTCAGGTGGTTG
AAGTGGGACGTGTTGTTTTCTCCACAACGGATGCAAGAAA
CTATGATGGTGCATCAAGCAGCAGAGCTCAGTTCACCTCA
GGAATGGACTCAGGTCCATTTCGGACTCATACACAAGCCA
GAGAAGAAGAGGATGAAAACCAAGAGGAAAGATTTGCTGG
CGGCATGACAGCATCTCCAGCAGAGCGCTCTGGTATTCCA
TCAAGCCTTACTAGCACTCTGGAGAACATTGTACAGCAGC
TGGACATCCTGACCCAGACCGTTGCTGTCCTCGAGGAGCG
TCTTACCCTGACCGAAGACAAACTGAGGACCTGCCTGGAC
AATCAGGTCCTGCTTATGCAACAAAACCAACAATTAGACC
GATCTGACGAGGAATCCGAGGGACCCCCGTTGTGATGGAT
ACCCAACCCTGGTGGCCCTCAACCCAATGGTAACTTCCTC
TAGCCCGCAGAGGGGGACACACCAAACTTTTTTTTTTCAT
TTTAGCTTAAAGACATCCAGCTGTGTCATTTCAAATGAGG
ACATTGTACTTAACAATGCAAAAAAAGGACACAAGATGAA
AAGACAAAAAGCAGGATGAAGGAAGGACAGGAGGGGGGAT
TAGAGGAGCAGTCTCACCCCAATAAAGTCATGTTGATAAG
ACATCTGCAGCTAAAACAACAACCCGCTCATGTTTTTTAA
GTGGCAAAGACTGTCATGGTCCAGACTTCTAGAATAGTCA
AACACATTTTTACTTGGTCTAAGTTTATGTCCTCTAAATC
ACATATATTACTTAGCTATAGGCCCTTATGAATGGATTCT
AGCCGGAGTCTCTGTTGTGATTGCATGAATGGTTTGTGGA
TGTGTATGTAGGATAGAGTACGATTGGGGAAGTGTCCTCA
GAGACACTTGCAGCCTTGTTTACTGTTTCTGGAACAGCCG
CAGCCTTGTGGCTTTCCTCTGGGTGGAGGTCAGACGGAAG
CAGAGAGCCAATCGACAGAAGGGCCCAGCGGTGCTTATTT
GCTTTGTGCGCCACATCCTTCTATCTGCAGCCGCTATGCT
AAACTCTGCCCAACAGTCTGACATAAAAACAATGCCTCCA
ACAGCAGTTGAAGCCAAATAAATAAATGGATGAATAAAAA
GATATCTGAGAAGCATGCTTTATTAAATACAAGTTCTTGG
GTCAGATCATAGAGGATTAGTGATGTCCACTGTAGACTGA
AGCTATTTTTATCATTCGGATTGTGATGTTATAAAACCTG
TATGACAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations