Community Action Needed: Please respond to the NIH RFI
Transcript

gata5-201

ID
ZDB-TSCRIPT-090929-9313
Name
gata5-201
Previous Names
  • gata5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026682 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026682|OTTDARG00000021094|ZDB-GENE-980526-340 gata5|OTTDARP00000021876 gata5-001 LG_ BX323800.8 Danio rerio protein_coding KNOWN, 2310 bp
GGAGTGCGTCACGTGGTTCTGCTCTAACAAATAACTCGCA
GTAAAGTAGAGAGCAAATCAGGGAACAGTTATATTAGGCA
TTATCTGCAGCAGCAGCAGTTATCTCCAGATACAGACAAG
CCTCGGTGACAAGCCCAAACGCGGAGAGGACAACTACAAG
TTTTTCGACTGTCGCTTATTTTCGCTGAAGTTTGAATTCT
GGGCTAAAATCAAGAAGAAAGAAGAGACTGGGAACCTCGA
CGGCGATATTCAATCAAGTCACTTGGAAGAGAGGGTTCCC
GACTTTATCACCAACCATCCTTATCTGGAAAGAATTTCAT
TTTCTGTGGCCTCTGATCAGGAAACCATCGCATTTGGAGA
TTTTGGACGTTAACAAGGTTTTTAACTAGCCTACAATCTG
GGCGAATTTTGAGATTTCGAAATCTAGCTTATTCACTGGA
TATATCATGTATTCGAGCCTGGCTTTATCTTCCAACCCGT
CCCCCTACGCACACGATTCCGGGAACTACATCCATCCGTC
TGCCAGCTCACCTGTGTATGTACCCACCACTCGTGTACCA
GCCATGCTCCAGACCTTGCCCTACCTACAGACTTGCGAGT
CCAGCCACCAAGCCCATGGGATCAGCAGTCACCACGCCTG
GCCACAGACTGGCACCGATAACTCTTCGTTCAACCCCGGT
AGCCCTCATCCACCGCCCGGTTTCTCTTATTCGCACAGTC
CGCCAGTGAGCAGCAGCACCGGCAGGGACGCCGCGTACCA
GAACCCGTTAATGTTAAGTAACGGCGGCCGTGCGGATCAA
TATGGAAGTGCCCTGGTGCGCTCCGTCGGTGGCTCTTATT
CCAGCCCGTACGCGGCCTACATGAGCCCGGAGATGGCAAC
CTCATGGACGCCTGGGCCCTTTGATGGCGGCATGATCGGT
CTTCAGGGACGCCAGGGAACTCTACCGGGAAGGAGGTCCA
GTATAGACATGCTGGATGACCTGCCGTGTGAAGGGCGCGA
GTGTGTGAACTGCGGCTCAATCTCAACGCCGCTGTGGAGA
AGAGACGGAACCGGACACTACCTGTGCAACGCGTGCGGCC
TTTACCACAAGATGAACGGCATCAATCGACCTCTTATCAA
ACCACAGAAACGCCTGCAAAGCACATCACGACGAGCAGGT
CTGTGTTGCACTAACTGTCATACTAGTACGACAACACTGT
GGAGGAGAAACGCAGAGGGAGAGCCAGTCTGCAATGCATG
TGGACTTTACATGAAGCTTCATGGGGTACCAAGGCCATTA
GCTATGAAAAAAGAAAGCATTCAGACAAGGAAACGCAAAC
CAAAGATGCCCAAAACCAAATCATCCTCAGGGTCAACAGT
GTCTGGCGCTACGTCTCCCACTTCACTGCCTGTGTCAGAA
AACGCCTCTACAATAAAAAGTGAACCTAGTATCGCAGCTT
CTCCATATGCAGGCCAAACCGTTGTCTCGGTCACACAGGC
ATCGACACAGTTGGATAGTGCCAGTTCTGCCCATGTGGAC
ATCAAATATGAAGACTACACATACACCCCGACGTCGATCG
CCCCACAGAACTCCTGGTGTGCTCTGTCTCAAGCGTGATC
CGAGACCTCCACTGAAACCTCTCTGGCATGGGAGAAAAGA
CTTTTAACTGAATCTACCTAATAGGACTTTTACACAAATG
TAGACAGACGGTGCTTAGGAAAGCAAGACATTGACAGTAA
TTTGTGCTACTTTTCCTCCTTGATTTATGGTGGCATATCT
ATGATGTCACGGCCAATTCATGCAATTCCACCAAAAATAT
GGTGGATGACAAGCAGCGCCTCTGTAACAGTTCTTGAGTT
CCAATGATCGGGAGGACAAAAAACATGCTTTTTATGGCTA
CTGAACGTTTCATGGCTTAGTTGTTAATGATTACCTTTTA
AGATACATTATTTATGTTGAGATAAGAATGGTGGAGGCAC
ACAAGTCTCTCTCCCATAATTCCCTTTATCCTTCAGGGAA
TGCGTCTTTATGGTCGTTATGACTTGAGATCGCATACTTT
CCCTGGATGAGGCCTTTTAAAAGTTTCCTTGTTGTCTTTG
CTGATTCCAGACTCTGTCAATGTTGTATTGTATTCCTCCG
ATGATCTGAAGTGCAATGACCCGCGCCGCTTTTCAGCCGA
TTTTGAAAAGGGACACGTTTATATTAATTGTTTCGAAATT
CTGTGTTTTGTTTTTTGTCAGAATATGTTAACCTAAATTT
ATTTGATGTATTTTGTTGATATATATTGGAATTATATCGT
TTCATGGCATATAAAATTGACCGACATCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations