Transcript

fibpb-203

ID
ZDB-TSCRIPT-090929-9211
Name
fibpb-203
Previous Names
  • fibpb-001
  • fibpl-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026561 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026561|OTTDARG00000021021|ZDB-GENE-040630-2 fibpb|OTTDARP00000038241 fibpl-001 LG_ CR388166.7 Danio rerio protein_coding KNOWN, 1445 bp
GACTGCGAGCACCTTGACATCATCCTTTCCTGCCATTTAC
AGACAACTCATGTAAATTTACACGGGCGTAAGAGATCATA
AACGGCCTGATAATATTTGATAGCAGCACGGATTGACGCG
CGTAAACAAACCTGCACGTGCGTGTTTGGAAATGTAAGTG
CGCAATAAGCTCAGCTCTCAGATGCGTCGCCGTAGATGCC
ACTTTCTGTTTTAACCTCAGCTTACGACTTCATTGACCGT
CTTTTCAGTTTTTTAAAACGTATATAAAATTACGAAAATA
TCCATGGAGTTGGATGTGTTTGTGGGGAACACCACTGTCC
TGGATGAAGATATCTACCAACTATGGTTGGATGGACATTC
AGTTTCAGATGTAGTAAGGCAGCGGATGGATGCAGGTGTT
TTGCTGGAGTGTGAAGCCAGTCCTGATGTTCTGCAGAGCG
ATACCATAGACCAGTTCAGAACATTCCAGATGTGTGAGCG
GCTCCTTCAGTCTCCTTCAAAAGTGGCCAATCAGCTTCTC
TTCCAGATCCCTTCTGACCAGCAGGCCATGCTTATCGAGA
GGTACTATGAGTTTGACAGTGTGTTTGCTAGAGAGGTACT
GGGTAAAAAACTCTCCAAAGGGACCAAAAAAGACCTGGAT
GACGTCAGTGCAAAGACTGGAATCGCATTGAAGAGCTGTC
GGCGACAGTTTGACAATTTCAAGCGCGTGTTCAAAGTGGT
TGAAGAGCTGAAAGGCCCTCTAGTGGAGAACATACAGCGT
CACTTTCTCCTGTCGGATGATCTGGCAAGCCATGTCTCTC
TGCAGGGATTATGCCACCATTGTATTCTTTGCTAACAGCC
GTTTTGAGACAGGGAAGAGAAAACTACAGTATTTGTCATT
CCAGGACTTTGCCTTTTGTGCTGGTCAGCTCATAAGCTAC
TGGACTGTGGGGGCCGTTGACAACATGATTGAAGATATGG
ACGTTGATCTTGAAAAAGATTTTCTACATGACTTGAAAGA
CTTGAAGGTCTTGGTGAATGATAAGGACTTGCTGGACCAA
CACAAAAGTTTGGTGTGTGGACAGCTTAGAGGGAAAATAA
AAGTCTTTAATGAGATGGAGGCCAGTTTTAAGAACTTGTC
AAGAGCTCTAGTTAACATTGCCTCAAAGCTTACACATGCC
AAAGATGTCCGAGATCTGTTCATTGACCTTGTGGAGAAGT
TCATTGAACCGTGTCGTTCAGATAAATGGACAAGTGGAGA
CCTCAGAGTTTTCCTCACACACTACAGCACCTCAGTACAT
ACACTAGAGGCTTTCAGGCATCAAGTAATATGGGACCGAT
ACATGGGTGTTATCAAAAGCTGCATCCTGAAAATGTACCA
TGACTAAAACACATGCTGCTAGTTATCGTGACCAAATTTC
CCCTTTATAAGTAACAATACAGTTTCTCTATGTTTGTAAG
CGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations