Transcript

efna5a-201

ID
ZDB-TSCRIPT-090929-9188
Name
efna5a-201
Previous Names
  • efna5a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026519 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026519|OTTDARG00000021004|ZDB-GENE-001128-1 efna5a|OTTDARP00000021753 efna5a-001 LG_none AL844141.7,BX510951.12,BX530077.4 Danio rerio protein_coding KNOWN, 4685 bp
GTTTTACCTGGTTCCTGGATTCAGACTCTGCTTCTGGTCC
CAAGTCACCATATGTGGTCAGCTACCGAGCAAACCTATCA
CACCAGAAAAGCCGTCCATACAGAGAGGGAAGAAACACAC
AAAGGTTTGGAACCACTTGAGGAAGAGTAAATGGTTCTAC
CGAGGAGACTACCACATTGATGTCTGCATTAACGATTATT
TGGACGTATATTGTCCGCACTACATGGACACTGTCCCTGA
GGAACGGACAGAGCGTTATGTCCTCTACATGGTCAATTAT
GACGGCTACAGCTCCTGTGACCACACGGCCAAAGGCTTCA
AGCGCTGGGAGTGCAACCGACCTCACTCACCCAACGGGCC
TCTAAAGTTCTCCGAGAAGTTTCAGCTTTTCACACCGTTC
TCACTGGGTTTCGAATTTCGGCCAGGCAGAGAATACTACT
ATATCTCATCTACACTGGCTGAAAATGGGAGACGGAGCTG
CTTGAGGCTGAAAGTTTTCGTCAGACCTACGAACAACTGC
GATAAAAGTCACGATCGCGTCGACAAATTCGATGATCGAA
GCATTAACTCTATAGAAAATAATAATGATGGAACAAGTCA
CGAATCTGCCGAGCCATCCCGAAGTGACGTGAACAGCGCG
GGACGTGTTCAGACTGTAGGGCCTTTGTTGGCTTCAGTTC
TGGTGCTTCTTGCCTCTCTCTCATCCTTATAGCGTCCCAT
ACAGACCTGAAGAATACAGGAGGACTCGTGATCGAGCACT
TTTAAGAAACATTAGAGATCCTTCTCTCGACTGAAATGTA
GTTTCTTGCTCTGGAAGATGCACGCCGATATAACTAGATG
GTTTTCGATGAATACAAGTTCCCCAAAACCGTCTCTCGTA
GACCCATGAAAAAACAAGCATACAAAAATAGGTCTGTGTC
CTCTCGGTGCCCCCATGTGACGCTGGAGAGGGCCTTGTAA
TTGGGGGCAGAGGAAGAAAAGGACTCTCTTTCACAAAGAC
CTCTTTCAGTGTTGCTGAAATCTTCTAACAAGAGCGAGAG
GACTATCTGAGGGATCTCTACAGGTGCATTGTGGGTAAAC
GTCGTCACTATGGACTCAACTGCTGACTCTACTAGATATC
AAGGCACTTTGTTGCCTGATAGCATAAACCTCATACAGAG
GGAGAGCAGGGAGCTTTTTAATATCTCAACCAGAGTAGTC
CGCACGGACTCAGGTGCTCAGGTGAACGGTGACAATTTTT
GAAGAGTTTTCGTAGATTAAAGAAAAAGAAAAGCACTCGT
TTTTTGTACATTGTGTACAGGTGGGACTGAAACGCAGATG
TGGTGTTCTTGAAGTAAAAACGCTCAAGTGTAGCTGCCAA
AATCGATGTTTTGTTAGGAGTACGAAGCCTCACGGATCAG
TGGTTTGAGTGAATATACTAATTTGTTTGGTGAATCATCG
TTTTTTCTTATTTATTGTTCAGTCTTAGTGCTCTTGACAC
TTTGTTTGTGATAGTCATCTGCCATCATTTGGGAGAAAGG
AACACAACTTAGCTTCAGTCAACTTACATTGGTTTAGATG
GCAACTTGTCATTAGGAGTAACGTTTTAGCAAGTCGATCC
TTGATACGTTATCAGGGAGAAAAGTTATATTTTCATATCA
CGTCTGTCAGCGGTCATAATACTCCTAACAATCTGGAGTC
ATTCAGTTGTTTTAGATTTTATTTTTTAGAAATCTCGTAA
CTTCATCATGTTCAGTCTTGGTCACTTTTGCGACGCTTCA
CAAAAAGTGAACTTAATCCTGAAAATCTAATTTTGTTTTG
TTTTGTTAAATCAGATCCACACTTTATGTTGCTTGCTGTC
AAAAATGCCATTAAATAAATACTGCTCTTTCATAACCTCG
AAATATATATCAACGAGACACTGTTTCGCTTAACTTTATT
TTATTATTTATTTAGAGAGAGAAACAAGCCTCTATTAGAA
ATGTATAATAATTAGGTTGTGAATATTTTTTAGTAAAATG
AAAATCCTCTGAAATATCACCCACTTCGAATGTTCTCATT
CAATTGAATGAGCGTTATCAGTGGTTATCAGCCGATAGAT
ATGGGCTAGTAGGGTCCCTCTGCTCCTTCTCTTGGGCTCA
GATGGCTGTTATAATCCATCCACATGGTTAATCATCTATA
CTAATAGAGAAAACTGCAGATCCAGATCAGCTTTTACATT
ACTGTAATGGTTGGGTTTGGGGTTGATGTTAGGGTAGACC
TTAATAATTACAAATAATGGGAAATTTAACAAATAATATA
AATAATTATTGTGGTTATTCATCTATACTCTTAGAGAAGA
CTCCAGATCTGCTTTTACATTACTGTGACAGTTGGGTTTA
GGGTTGGGGTAGAGGTAGACATTAATAAAAACAATTAATG
GGGATTTAATAAATAATATAATAATAAATGATAATAATAA
TATTTATTTATTATAATAATAAATAAATAATTTAATAAAT
AATATATCTAGTTAACTTCTGGCCGCAGTTGTATGTGAAC
TATAGATGATTAACCATGTGGGTGGATAATAACAGCCTTC
AGAGCCTACTAGTAGTTGCAGAAAGCCCCTACCCTGCAGC
CACAGGATGTCAACATGACTTCATATTGATGTTGTACCTG
TACACCAACGTCATGGGGATGTTAGAGTTTGTTTGTAAAT
GATTTTAGGTTGGACATTGACATTGGCCTGATGTTGGGTT
CTGACGTCAAACCGATTTTCAACCTAAAATTATCCAAATA
TCAACGTCTGTTCATGTTACACCTTGACATTGTTTGGACG
TTACCACTATGACTAGTGGTATCGTGGTATACTAGTGGTA
TACTAGTGGATCTATCAGACGTTGGATTTTGGTCACTTTC
CAACACAACCTAAAACGTAATTTGACATCGTTATTGGACT
TCAAAATAATTTTGTCCTTAGACTCTGGCTAGACATTGAA
TTTTGGTCAGCTGACGTCACTCCCTAAATATAACTTAATT
TTAAACATCTTATGATGTTGTGTGCCTGTGCTCAGTACTG
GCCCATATCTATCAGTTGATAACCACTGATAACGCCCATT
CAGTCGAGTGATAATATTGTCGAATTGTCTGGAAATATCC
AAATATTAAAGTAAAATGTAATGCATTAATGCTATAAACA
CTGAAGCATTTTACCGTTATGCCTTCTTGCCTGTAAACAA
CACAAATGTGTCTCCTAAATGAACAAAACCAGAAGTTTAA
AGTTCATTATTACAGATGAGCAGAGGTAGGAAGTAGTTGA
AATTCATTTTTGCAATTGCTTCCTGTCTTTCTAGCCTAAA
GTAATCACAATGAACAGCATTAGCATTTTAATTGGGTCAA
CAAAAACTGCTAATTTATGTTTTTAAAAAAAAGAAACGTT
TTTAAGGATTCTTTTTCTTTCTAAGCATGAACTGAAAGCA
ATTAAATTATTTTCTTACATCCTCGAAGCGAATTCTCACA
CAGGCTTTTCTTTAATTAACATGAATTGTGCTGTTTTTTA
TTTATTTATTTTTTTAAACACAAAGTCGACCGCACTAAAA
GCTCATCTGAGATGTCCTGAAACAGTAGCGGGACGCTGCT
TCCACCCGGGTGGCAACTGACACCCTAACATGATTTAATA
GGCTCTTTGATGTTGTCCAAAGTGCCTGGCACGCAGACCA
CATACTGCGAGGCCTCATGTGGGTTATTTCTGGAATTAAA
AAAATCGACAGCAGCACAGGAGGAGCGCGGTGTCCAGTTC
AGCCGCAGGCTAGCGTTACTCCAGTGAACTTGGCCAGAGA
TGGAGAAAGATGAGATCTCCTGCTGGGATCAATAGTAATG
GCCTTTACAGACACAAAAACAGGGTAAATATTTGCCCCGC
TCCTTGTTCTCCTTGCTTGAATGCTTTTCCTGTTTTCCAT
TCACATCTACGTGTCGACGTCTGTATGGATGCTGTGTATC
CGTATGTTGTCTAGCAAAGCATATCATGCAGTGATTTGGA
GCATAAAAGAGATGAGATGAAGCCTTAACCTAGTCAAATC
AGATATGTTTGGTCAGACTACATTTACTGATTAATTTGAT
TACCTTAGATTGTTTGGTAACCATTAAAAATAAGACATTT
AAAATAGTAATTACTTATAATAATGTGCTTTGAAAGACAT
CCTCATTCTTTAAAAACCTCCTGTGGAACATTTTATGGCT
CCACAAAGAAATGCTGTCGTCCATTTATTGTCATGGGAAC
AAACCTAGAAGGACATTGTTGGGTTTAATTCAGGAAGAGT
TATTTTTGTAAATGGCCTGTAGTGTCTGTCTTTGTCCATA
TGCAACATTTTACACGGAGGTCAAAGGAATCTCATTGAAC
GTCCTGGGTTTTTTCCACCACAAGGCAGTTGTGTTCCTGT
GTTCTCTCCTCATTTTGGTCCCGGTGTTAGACATCATTTC
CTAATTCTCTCCACACCTGCTTCTTCATACAGCTGTGAAG
ACCATGATATCTAAACCACCATTTCCCTTCACTTCTTGGC
TGTGTTGCCTGAATAGTAGACATTTGCTATGACGTCGCCG
ACGGTGCAGCGCTGACTTGCATTATGATATGACACCTTTT
TATATCTTCAAATGCCATTGTTTGTAAATACACTTGCTGG
AACAGCTCAAATAAATGATTCAATAAATTTGTCATTGTTG
TAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations