header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9074
Transcript Name: fgfrl1a-201
Previous Name: fgfrl1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026397 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026397|OTTDARG00000020928|ZDB-GENE-040128-2 fgfrl1a|OTTDARP00000021659 fgfrl1a-001 LG_none CU302200.5,CR352289.7,BX004830.7 Danio rerio protein_coding KNOWN, 3132 bp
GGACGGCGAAACATTTGGTTAACGGTATTTCAAACACCGT
TTGATACATATTTAGGTGCTGTTCGCAATTTCACCATGCG
TGTTATTTGCTACCTGAAGAATACATGGACATAAATTCGC
CTTGAATTGAAGTGCGTGCGCAACAGGGCGCGCGCGGCGG
CTGTCTGTCATCTACAGAAGTTTACGGCAATCAGCGCGTG
TATTAAAAAGTGTCGCGCGAAAATACATGACGTCAGAGCG
TCCAGGAATACAGTCGCGCGTGATAATTAAACAGATTGAA
AGAGCTGGATCCAGGGTTGCGAGCATGTGGATTTCTGATG
TAGCCTCCAGTCTACATGAAATGTCTGGAGTGTTTTAAGA
GGATGTAACCTTAAGCATGATATTTTACCTACTAGCTGCG
AGGAACAGATTTCTGATCATACTTTCAATTGTTGATTGAA
GAACCAGAGAGCTTTAATAGGGACATCATGGAACTTCTTT
GGATAGTTTTCTTCATTTTTGACATTATTTTCATCACAGA
CTGTGCTAGAGGTCCTCCACGTGTAGCAGAAAAGATCGCC
CACCGGCAGACTGTCAGAATCGGTCGCACCATGAAGCTTC
AGTGTCCTGTGGAGGGTGATCCGCCGCCCCTCATCATGTG
GACCAAAGACGGACGAAACATTCACAGTGGCTGGATGCGC
TTCAGGGTTCTTCAGCAAGCTCTCCGCATCAAAGAGGTGG
AGGCAGACGATGCTGGGACGTTCATTTGTAAAGCCACCAA
TGGATTCGGCAGTGTCAATATCAACTACACCCTCATCGTC
ATTGATGACTCCAGCGCCGGGAGGGAAGGTGCCAGACCAG
CTGGTGAAACCGAGTACTCCACTGACCTGACTGGAAAACT
GGTGCGGCCTCGCTTCACTCAGCCAGCCAAAATGAGAAAG
CGTGTGATTGCCCGCCCAGTGGGCAGCTCCGTGAGGCTCA
AGTGCACAGCCAGCGGAAACCCCAGACCGGACATCGTCTG
GCTGAAGGACAGCAGGCCTCTTACACCCGAAGAAGTGGGC
GAGGGACGGAAGAAGAAATGGACTCTCAGCCTGAAGAACC
TGACGCCCGAACACAGCGGCAAATACACATGTCATGTGTC
CAACCGCGCAGGAGAGATCAACGCTACCTATAAAGTGGAA
GTCATCCAGCGCACAAATTCCAAGCCCATCCTGACGGGCA
CTCATCCAGTGAACACTACAGTGGACTACGGTGGCACCAC
GTCCTTCCAGTGCAAAGTACGCAGTGATGTCAAGCCGGTC
ATCCAGTGGTTAAAGAGGGTGGAACCGGGCGGCGAGGGCA
AGTACAACTCTACGATTGAGGTGGGAGACCATCACTTCGT
TGTGTTGCCCACGGGTGACGTGTGGTCACGACCTGACGGC
TCTTATTTGAACAAACTGCTGATCACTCGAGCCAAGGAGG
AGGACGCCGGCATGTACATCTGCCTGGGGGCAAATACCAT
GGGCTACAGCTTCCGCAGCGCCTTTCTCACTGTGCTGCCT
GACCCAAAGCCACCGTTCTCCCCGATCCCATCAGTTCTGC
CCCCCAGCCTCCCCTGGCCTGTCATCATCGGCATCCCCGC
AGGAATAGTCTTCATTCTCGGCACTGTCCTGCTCTGGTTC
TGCCAGTCCAGAAAGCACTGCTCCTCAGGAGCCATAATCT
CAGCCCAAACGTTACCCAATGGCCACCGGCAGCCACCCAG
AGACCGACCGGCCGATAAAGACTGCATCGCCTCAGTCGCC
TACGAGGAGTATCTGGCCCAACAGCAGCAACAGCAGCTCC
TGCTGGCTCAATCGGCTCCTAAAGTCTACCCAAAGATCTA
CTCAGACATTCACACGCACACACACTCGCACGTGGACGGC
AAAATTCACCAGCACCAGCACATCCACTACCAGTGTTAGC
ACGGATTGAGGCCTTCTAGTTCATCACACACTTTTCTGCA
GTCGGCCAAACAGACATTTCAGCTCAAAAGACACTTTTAA
CCAATCCCTCGCTCTCAATACTGCCAAGACATTATGAACA
AACGAGGGCAAGGCTAACAAACAAATGATATTTGAGTCTG
TTTGGAAACGGAGAAACGTTTCACTTGCTGACACTCTGAA
TGGAACAAAAGACAAATCAGCCCATTGACTAATCTCGTGG
ACGGGGCCAAAAGGACTTTTTCGATTAGCACCAAATCTCA
GTGAAACGTCGGTTTTGCATGCATATGAAAATGGTTTGCA
GATATATTGAGTTATGGTTATAGTTACAGAGCGACCGAAT
GCATGATGGAGCGTATGTTCGTGTTGATTTCGCAGGTATG
TTCTTACCTAGTGTACCTTTCGTAACTAAAGATAAAGTTA
TATCGTAACTAAAGATACGATAAGATTTTGGCATTGCATC
GTACGTTCTGGCAAGTGCTTCCTTGTGTTTCTCATTAATG
TTTTATTTTCAGGGCCTGCTCTGAATAACCTGCGGTACCG
CAATCCCATAGTTCCTCTATGGCTTTGTTTAGTGTGTGTT
TGTTTGGGAGGGGAGATGTATTTTCATAAGCTTGACCACT
ATAATGAAGACTGTGTAAAATGCCTTTGACTGCTCATGTA
ATGGCTCCCCTTTAATATTTACAGAAGTGAGTCAGAGTTT
CGAAAACAAACCTTCAAATGAAACTCGGATGTATTGTGCA
TTGTTTGCGCATCGTAAAGGGTCAATGCTAAGAGGACTGC
GGGAGTACAGGAATGCACTTAACCCAGACATCTGCTAGCG
TGAACTCTTGTTGTTTTTAAGTCAGCCAAAAGAGGAGACC
TGGTCTAAAACAGTTAATTTATTCGTGAGCAATGTTTTGA
TGCTTTGAATCGGGCATTATCTAGATGTTTTAAACCAAAT
ATGAGTATACATAGCATCGTCTTCCTTTAGCTGCAGTGTA
AGCTATGTAGCATATATCAAGTGTTAAATATTTATATGTG
ATGTTGGAAAAGAAATAACACAACGGTCGTTAATTAGTTA
TCTCGATATGGACAATCTTGTACAGTTTGGCCTGTTTTTA
TGTTTTAAAATATATGTTTGTCACATTGAAACATTAAAAT
CATTTTAGCATTATCATAAAATGATAAAGCTCTTGTTCAC
CAGGTATGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fgfrl1a-201 Contained in:
OTHER fgfrl1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026397 (1)
  • Ensembl_Trans:ENSDART00000082667 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CU458922 (1) 2775bp
    GenBank:BC053245 (1) 2774bp
    GenBank:AJ574916 (1) 2749bp
    GenBank:CO807271 (1) 861bp
    GenBank:CA473748 (1) 832bp
    GenBank:EB893616 (1) 605bp
    CITATIONS (2)