header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9033
Transcript Name: mef2d-201
Previous Name: mef2d-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026356 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026356|OTTDARG00000020909|ZDB-GENE-990415-164 mef2d|OTTDARP00000021633 mef2d-002 LG_none CR848841.19,CR938717.8 Danio rerio protein_coding KNOWN, 3778 bp
AATTCATTACAAGACCCTCATCATCTCCATCACCAGATTT
TTCCAGGGGGGGTTTGGATATCAGAACAGACACCTGTCGG
ATGACATGCACCCTGAGCAGACCATGATCTGAAGGCCCTA
CCAGGAGGCCACACACTTTCTTTCTTCCTTCCCTCCTTCC
TTTTTTGTCAGTGGAGGAAGACGGGTGAGCCCAGCTGCCT
CAGACAGGTGGCAGAAAGAGAGAGAGAGAGACTCTCTCAC
ACACACTCATCTTCATACACCAAGACGAACAGCCACTGTT
GTGCTCCTTTAACTGCCTGGAGAACATTTGACCTCTGACC
TCACCACACCCCCAACCTTGCCCTTCCACCCCTGCACGGC
CAATCACAGCAGCCATGGGGAGGAAAAAGATCCAGATTCA
GCGAATCACAGACGAGCGTAACAGACAGGTGACCTTCACT
AAACGGAAGTTTGGTCTGATGAAGAAAGCCTACGAGCTCA
GTGTGTTGTGTGACTGCGAGATTGCCCTCATTATTTTCAA
TCACTCAAACAAGCTCTTCCAGTATGCCAGCACTGACATG
GACAAAGTGCTCCTCAAATACACAGAGTACAACGAGCCAC
ACGAAAGCAGGACCAACGCAGACATCATTGAGACGTTGAG
AAAGAAAGGCTTTAACGGTTGCAACAGTCCGGAGCCAGAC
GGAGACGATTCGATTGACCAAAGTCCATTACAGGAGGACA
AATACCGGAAGAGCGAGGAGCTGGATATCCTCTTCAAACG
CTACGGATCCACAGTGCCAGCGCCCACTTTCTCCATGCCA
GTCACAGTGCCGGTGTCCAATCAGAGCCCGTTGCCATTCA
GCAATCCAAGCAGTCTCGTCACCACTTCCTTCGTCACCTC
GACCCTCACAGACCCACGCCTGCTTTCACCACAGCAGCCC
CAGCTCCAGAGGAACACGGTTTCTCCAGGCCTGCCACAGA
GACCCGCCAGCGCAGGTGCTCTTCTGGGTGGTGACCTCAA
CAATTCAAATGGAGCGTGCCCGAGCCCTGTGGCCAATGGT
TACGTCAGTGCCAGGGCCTCCCCAGGACTCCTCTCAGTCT
CCAACGGCAACAGCATGGGGAAAGTAGTCCAGGCTAAATC
TCCACCTCCGCCCAGCACTCAGATGGCGAACAGCCGCAAA
CCGGACCTTCGGGTCATCACCTCGCAGAGCAGCAAGGGCC
TTATGCAGCTGAATGCTCAGCGGTTAGGCACCTCTCAAGT
GACCCAGCCTCTTACCACACCAGTGGTTTCCGTGGCAACG
CCGAGCCTCCTAACTCCATTCTCTATGCCCACCGCCTACA
ACACAGAGTACCAGCTAACAAGTGCAGATCTCACAGCCCT
CCAGGCCTTTACGCCGTCGGGCGCACTGTTGCCAGGCAAC
ATGACCACTTGGCAACAGCAGCAGCAGCCATCTGTATCCC
AGCAACCACAGCAGCAGCCATCCGTATCCCAGCAACAGAC
TCAGCAGCAGCAGCAACAACAACAACAGCCACAGCAGCTC
ACTCTGGCCTCACTCAGCAACCTTGTGCCCGTAGGAACAA
TCCCTCATGGAGCTACTCTGACGGTTAACACTAACCCCAG
CATCAGCATCAAATCCGAGCCAGTGTCTCCCAACCGGGAC
CGCAGCACCCCTAGTTCCACCGCCGGGGCAGTGGGTGGCG
TTTCAGGCCTGACGGTGAGCCAGTATCCAGGGACACTGCG
TTTGGAGCCCACCGGCCGCTCTCCAGTTGACAGCATCAGC
AGTAACGGCAGCTCATACGAGGGAAGCGATCGAGACGACA
GCGGCCAGCCTCGCCCTCCAGATTTCTCCGGCCTAGGTCT
TCTCCGAGCTACCGGAGACCAGCCGGCCCAAGCAGAGCAG
CAGGAGTCAGCCAACGTGAAGCGTATGAGACTGGACACCT
GGGTCACATAAACGCTGAAGGAAAGCGAGAGACATCTGCT
CTCTCACCCGCACATACACACGCACGCACACCGACAAAAA
AAAACACACCCCTAGTGGCACCTGCCAATCTCAGTCCGCA
CTTAGACACATGCATGCGCCTGTCTCTCTGTCTCACTCTC
AGACACACACATATATTTACTGGTGTGTGTGTTTATGTAT
TTATATAGAATATGCATATATGATCACACACGCACTAGAT
CCTCCTCACACACACATACACAGTTGCCAATCCAGGTGTA
AACGTGTTCACGAGACTTAAGAGATGTACAAGGCAGAACA
GAAGGGCTGTCGGTGGCATCTCTGATATCCCTAAGAGGCC
GTCCGGATCCCAGATCAACTTTTCAACAGGATCAGCAGGC
CTTACCGTCGACCTGATCGGAGTTCAGCGGCACTGCTCTG
TCCAAACAGCAAAGCAACTGCTTGATATGTTGCGTAGACA
AGCCTGTCGATCTCTTTTCTCTCTTCTTTTGTATTGATTT
CTCTCTGGTTTTGTATGAATGGGTGCTTTTGCTATTTATT
TTCTCGAGTGACTTTTTCTCTTTTGCTTTTGCAGGTTTTT
TGTTTGTTTTTGGTGTGTTTCTGCTGCCTTTAGTATCGCC
CTGTTCCTTTTGTGACGACTTTTAAGTCGAATCTTTATCT
TTGTTTTCCTATCTACGCATAGTGTGCATGTGTGTGTGTG
TCAGCTGTGAGACCGAGGCGCTCATTCATTCAATCGCTAA
ACACAACTCAGCCAAAAAGCTCCACTCGATCATGTTTATC
ATCTTCCGTCGTATTGTAATCTGGCACCAGTCCCCTGCGT
GCACACTCGTGTGCGTGTGTCTTATCGGCGGAGCTCCAAG
CGCAATTTTCTGCGTCCACGTGGACCGCGATAGAAATGTA
GATCTGTGTGTACTTGTGAGAGAAACACATTAGACGGCAG
TTTACGAGAGCAGCGGTCTGCCACATTATACTCTATTTAT
TGTTTTGGATGCTTCGGCTGCGTAATTCAGAGGTTAAGTA
GTTAACTTTATGGGACGAGTATGCTTAATTAACGTTTGTA
AGATTCCAGGATTTAAAAAAGTCAAAAGACGAAGTCTTGA
GTTGTTGTTTAACTCAAGATGGCGAGGTTTTTTTCTGTTG
TTGTTGTTGTTGTTGATGAGATGACGTGTATATACAACAA
TTTTCTCAGTGTTTCAGTACAGGTTTATGTATAGCATACA
GAGTTGCGTATCTCAGCTAGGTTATTTTAGCTAAGAAAGA
GATGGAGGTCGTGTAGCGCTGAGTGTGTGCGTGCGTGCGT
GTGTGAGAGAAGCGTTGAGATTGTACATAGCGATGTGTGT
GTGTTCACATATATTCAGCTGGGTCTTTCTGAAACAGCGC
TGTAATCTCAGTGGAACCGTCTCTGTCAACCTCTACCTGT
AAATAAACTGTACCGTGTTGTAAGTTAGCAAGGTGGAGAG
GCAGACGAAGGAGGATTTGACTGTTTAAAGCGTGACTCTT
ATTCTGTCCTTTATATTCTGATGGCGCGCACTTTAAAATC
TTCCCCCTTATTCATCAGCTCGCACACCTCGGTGAGGTAT
TTAAGGAGCGATGTCCTTCATTAACACATGATCAACCTGT
CATTTTTACACCTGCCCCCTTTCTCAAGAGTGATTTCCTG
ATGGTTTGGAACGGAGGACGAGCTCCTTTCACTTTTAAGA
TGCTTCAAAGCATTCAGGGAAGGATGTTTGCGTTTCATTT
TTGTGAGCTAACGTTATATTATGGCTTATTGCACTTCACA
TGTTAAACGGTGAACTATAACAGAAGAAAATGTCACGTTT
TGTAAAAAAAAAAAAAAA

mef2d TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA mef2d-003 (1) 1610
mef2d-004 (1) 543
mRNA mef2d-201 3778
mef2d-203 (1) 5585
mef2d-206 (1) 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mef2d-201 Contained in:
OTHER mef2d-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000026356 (1)
  • Ensembl_Trans:ENSDART00000009826 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC098522 (1) 4010bp
    CITATIONS (2)