Community Action Needed: Please respond to the NIH RFI
Transcript

zic2a-201

ID
ZDB-TSCRIPT-090929-8726
Name
zic2a-201
Previous Names
  • zic2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026030 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026030|OTTDARG00000020717|ZDB-GENE-000710-4 zic2a|OTTDARP00000021382 zic2a-001 LG_ BX469902.7 Danio rerio protein_coding KNOWN, 3177 bp
GGACCCTCCGAGATAAACATAGACAAGCGAAAGAAATAAA
CATTCCAATTCGAGATGCTTCAAGAACCAGGAAGGCTCAG
TAAGATATTGACTCGTATTTTCGTGTAATCCGCAAACAAC
GACATCGACTCAGTTTGAAAGGAAAAACGCAAAGGAATCT
TTTCATTTCGTTGCATTGGGGATTTTGAGTAACAAGTTAT
CCGCAAGAAAAATATAGTCTAACTTAATACGCAAAGCTTT
TTTTTCGCCCTGTGAGCGGGGATTGAACTTCATCGCCTCA
TGTCGTGTTGTCAAACCTGGAAGTTAATATTACCGTAGCG
CATTTTATTTTATTTCATTTTCTTAAATGTTTTGTTGAAG
CGCCGTGAATAGACTGCTTGAAAGAGAATTGGTTTTGCGC
AACGAAAACATGTTACTGGACGCAGGGCATCAGTTCCCTG
GTTTGGGAGTGGGCACCTTTGCCAGACATCATCACTCCTC
TAGTGAGATGCAGGACAGAGACTTGAGTTTAGCGCAAAAC
AGCTTCGTCGACTCGGCGCACATGGGCGCCTTCAAACTGA
ACCACGATCTCTCGCCCGGACAGAGTTCTGCATTCACGAG
CCAAGCGCCCGGTTACCCCGCTGCGGCTCTGGGTGCGCAC
GCGGCTCATGTCACATCATATGCGAGCTCGCCGTTTAACT
CCACGCGGGACTTTCTCTTTCGCAGCCGTGGATTCGGGGA
ATCATCACCGGCAGGAGGCCAGCACGCACTCTTCGGCCCC
ACTGCCGGCTCGCTCCATCATTCTCACACAGACAGCCAAG
GCCACATTCTGTTCCCTGGCATTCACGAACAGCATGGATC
TCACGGCTCCCCAAATGTGCTCAATGGGCAGATGCGACTC
GGACTACCAGGGGAGGTTTTCGGGCGATCAGACCAGTACC
ACCAGGTCTCTAGTCCGAGAACCGATCCTTACTCGGCCGC
CCAGCTGCACAACCAGTACGGCTCCATGAATATGAACATG
GGGATGAATATGGCAGCGCATCACCATCACCCCGGTGCCT
TCTTTCGCTACATGAGGCAGCAGTGCATTAAGCAAGAGCT
CATCTGTAAGTGGATCGATCCGGAGCAGCTCAGCAACCCT
AAGAAGAGTTGCAATAAAACTTTCAGCACCATGCACGAGC
TGGTCACCCACGTCTCTGTCGAGCACGTTGGAGGACCCGA
ACAGAGCAACCATATCTGCTTTTGGGAAGAGTGTCCGCGG
GAAAGCAAACCATTTAAAGCCAAATATAAACTGGTCAATC
ACATCCGCGTGCATACGGGAGAAAAACCTTTCCCCTGCCC
GTTCCCTGGATGTGGCAAAGTCTTTGCAAGATCAGAAAAC
CTTAAGATACACAAAAGAACACACACAGGTGAGAAACCAT
TTCAGTGTGAGTTTGAGGGATGTGATCGACGCTTTGCGAA
CAGCAGCGACCGAAAGAAGCATATGCACGTCCACACGTCA
GACAAACCATATCTCTGCAAAATGTGTGACAAGTCCTACA
CTCACCCCAGCTCTCTTCGAAAGCATATGAAGGTACACGA
GTCATCCCCACCTGCATCCGACTCGTCGCCAGCGGCAAGT
TCTGGTTATGAGTCCTCAACACCCCCTGGTCTGGTGTCTC
CCTCCACTGAGACCCAAAGCAACAACAATCTGTCGCCTTC
CTCAGCGGTCCACAGTTCCAACAACCACAGCAGTTTATCG
TCTAATTTCAGTGAATGGTATGTTTAAGACTGTGCCATCC
CAGGAGGACCCGATAAAGAAAAACAGGAGATCCATATACA
GCTTGTACAGAACGAACGCTTGAATATTACGCTCTTGTCC
AGCAGGATATAACATTCCTACATCGACAGAAGAAACGTGC
GCAAACGCACCAAACATCTCTTTTTTTGTACATACTACGC
GCTCTCTTTCCTAATGGTTGTTATAGATTTTGTCGGTTTT
TGGTGTATAGATGTTCCTTCAATGGTAGCTATTTCTCTAA
CTGGACTTTTTAGTGCACATATTACCATAAAGTTGTATTA
TCATAATGAATATTGTGATCCCATTAAGGCAAACTGATTG
TAAACTAAACAACTATTAACTGGAAAGAGTGCCAAAGTCA
ACATTTAACGAAGAAAGACACAATATTTGCTTGTGAATGT
ATATCTTAGTTTGCTGGGCTTAACTTGTGATGTTTTGTGC
TTTGCAAGTTTGAATTGTGAAATATATTTGGAAGATTGTG
GGGCAAATTAATGTCGTGCGGTTAAATATCTGTAACTACA
CCCTTCTTTTTGTAAATATCGACTGCCATATTTATCCATT
TGTAATTAAATTATGGTATTTACTTACTACAGATGAAACA
ATATTTATAAAGAATGTTTCTTTACTATAAATATGTACAA
TAATGGGCTAAACAGGGGCATTTGTTTTGTTATATGTGTT
TTTGTTTAAAGTTTGAGAAGTGTTTTCTCCATTATTGTGA
TAAAATTTTACTGCATACAGATATAATAAAACGTGGTGCA
AGTGTACAATCTTTACAACGCGTCGTGTTCATTCCATGTT
ATCACTTGTATTTGTTAGTGAACTTTGACAACTTTTAGGC
TTTAATGTTATTAACACTATAAATTATCTTTAAACTAAAC
TTCTGGCAGTTATCTCAAAGCTAGATAAGCAGATAGCGCT
GAATTATCTCTCCATTAACAATTCGGCGTTTCAAACTCAT
ATCTGTAGAACTGACTTGAATGTTTTAGCATTTTAAAAGA
AAAAAAAGTACATGCGTTTTTCAGTGAGCAAAAACATCAT
GTAAACTGTAAACTAGGAGTTTATAGCCATAATATAAATA
AGTTATTAATAAGTAGCCTATTTTCTTTACTAATAAAGTA
AGATTTTATTTTTTGATTTAACTTTGGATAATGCCATATC
CTTTCACGCTTAAATAAAGTTAAATAGAGTTTAAAATCAA
GTGGCCGTGAACTTGAACTTGACTCTGGCACTCTTGTAAA
GCTCTGAAAAAAGAAACATTTTCCCGCAAAACTAAGAGCT
GTCAGTTTCTGCAACTTGTTCGCTCAATTGTGAGTCGGAT
TTTAGTCTTTCATAATCGTCTAGATACAGCAACATTCAGC
CGAGAGCCAAAAACGCGGAATTAAATAAAAGGCATTTGAC
ATTGTGCCGAGACATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations