Transcript

cldna-201

ID
ZDB-TSCRIPT-090929-8644
Name
cldna-201
Previous Names
  • cldna-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025944 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025944|OTTDARG00000020670|ZDB-GENE-010328-1 cldna|OTTDARP00000021314 cldna-001 LG_ CR382327.27 Danio rerio protein_coding KNOWN, 1943 bp
CTCTACAGACCAACGAATATTTTTGCTGTCTAATACACCT
GCAATTGTTCCACCATGGTATCAGCAGGGCTGCAGATGGT
GGGTATAGCCCTGGCAGTGATTGGCTGGATTGGGGTTATA
GTGGTTTGCATTCTCCCCATGTGGCAAGTCACTGCTTTTA
TCGGACAGAACATCGTCACGGCGCAGGTTACCTGGGAAGG
AATTTGGATGAGTTGCGTGGTGCAGAGCACCGGACAGATG
CAGTGTAAAGTCTATGACTCCATGTTGGCTCTGAGCTCAG
ATCTTCAAGCCGCTCGAGCTTTGTGTATCATCTCCATCCT
AGTCGGTGTTGTTGGAATCCTCCTCGCGGCGGCGGGAGGA
AAATGCACCACCTGCATTGAAGAAGAACGTGCCAAGGCTA
AAGTCTGCGTTATTTCTGGAGCCATCTTCATCGTGGCTGG
AGTTCTGTGCTTGATTCCTGTTTGCTGGACTGCTAATAAT
ATTATACGCGACTTCTACAACCCTATGACCAACAGCGCGC
AAAAGAGGGAACTCGGAGCGTCGTTGTTTATTGGCTGGGG
GGCTTCGGCGCTGTTGATTATTGGCGGGTCGTTGCTTTGT
GCTAATTGCCCTCCACAAGACCAGTACAAGGCAACGTACA
CCGCTCGATCTGGAGGAACCAAGGGGTATGTCTGAGGAAC
CAAAAGTACTACATTCAAGGAGGATATTGGGTTTTTTATG
TGTATTGGATGCTGGACAGCTTTTGAGGTGGTGTTGTTGT
TGACTATGATCGTGACCGTTATTTTATTTAAAATAACGGT
CGACATATTCAAAAACTGACGGTTGTTGTTTGTTCATGCT
ACTTAAAATGAGCTAAAACAAGTGGAGCCAACTTAATTGT
TTGATGTTCAATCCACTTAAATGTGTAAAAACTATTAAGT
GATCTTAATTCATTCATTCAACTTGTTAAAATCAAATCTA
ATCGTTTTTTTTTTACAGTGTATGAGGCATTGTGAAATAC
AATGAACATGTCAGGGTGCCTGCTTTGAATGGAATAAGTG
TTCAATAAGTGTTTTAAATTGTAAATATAGTTTGTTTTAC
TTGGTATTTACTGTTCTTCAAGTGGTCTTGTGAGTTTCTT
TTTTCTCCTCATCTCAATATTTTGTGGAATGTTTTAAAAC
GCAACTAGGCATGGGACGATAAAGGTTTTCAAGGTATACC
GCGGTTTGGAAAAGTCAAGGTTTTAAAACAATTTTTTAAA
CAATAAATTAAATACATTTTTAATAATTTTTAATAATGTT
TTTTATTTACCTTTTTTAGGACAACAGCAGAAAAGATATC
CAAAGATGCCATTTTTAATTGTAAAAAAAATCATTTTTTT
AAATAAATCAAGACAGCAGATGTAAACAATCATTTATTTT
AAGGATTTATCCTGAAATGTTTACTATTTCAAAATATTTC
AAATGTTTCTTAAACTAAAATATATTGTGTTGAAAAGTGA
AAAATGTGTTTTTTACCCAGGCATTTAAAAAGAATATTTT
TAGAGCAGTAATCACAATAAGCTTTAGTCCAAGGTTATCA
TATTGTCAGAATCTTATACCAGCCCATGCCTACCTGTAAC
CACTGACATCCACAGTAGGAAAAACAAATACTATGGAAGT
CAATGGTTACTAGTTTCCAGCATTCTTTAAAATATCTTCC
TTTGTGTTCAACTGAAGGAAGAAACTCATGTTAAGTGATC
AAGTAGGCTACATGATGACAGGATTTTCATTTTTGAGTGA
ATTGTTTCTTCAATTTTTCTTGTTTTTACTGAGAATCTCT
TCAGAAGTGCTGAAACTGTACATGATTTTTTATTAAAGTT
ATCTTTGATCATATTTTGCTTCAATCCTATTTTGAAATTG
TGACTGATATGCCACAGAACATTTCAAATACAAGAATTTT
ATCGAATAAATCCTTTAAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations