Transcript

rbp2a-201

ID
ZDB-TSCRIPT-090929-8636
Name
rbp2a-201
Previous Names
  • rbp2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025932 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025932|OTTDARG00000020661|ZDB-GENE-020320-2 rbp2a|OTTDARP00000021305 rbp2a-001 LG_ BX088654.11 Danio rerio protein_coding KNOWN, 669 bp
AAAGAACTCTGTCCTTACGGGTCATTTGATCTCACACACA
CACAGCTATAAAAGGCCACGGTTCACCTCATCCTACTCTT
CTGAAATATACAAACCAGCACATCCAGCTTCACAATGCCA
GCCGATTTCAACGGCACGTGGGAGATGCTCAGCAATGACA
ACTTTGAAGATGTCATGAAGGCTTTGGACATCGACTTCGC
CACCCGTAAGATCGCAGTGCATCTCAAACAGACGAAGGTC
ATTGTGCAGAACGGGGACAAATTTGAGACCAAAACTCTCA
GCACCTTCAGAAACTATGAGGTCAATTTCGTCATTGGAGA
GGAGTTTGACGAGCAGACAAAAGGCCTGGACAACAGAACT
GTTAAGACCCTGGTAAAGTGGGATGGAGATAAACTGGTGT
GTGTGCAAAAGGGAGAAAAGGAGAACCGTGGCTGGAAGCA
GTGGATTGAAGGAGACTTGCTTCACTTGGAGATTCATTGT
CAAGACAAAGTCTGCCATCAAGTCTTCAAGAAGAAAAACT
AATGCTCCAAAAAGGCAGCTGGTTTTTCACTCCTGGGTTT
AATGTTGTGCTGTGTGTATTTATTAAAGCAATTTTAATAA
ACAGCCAAAAACTTTCATTCGGTGGTCAGCATGAGAATTT
CAATGCAGCAAATAAAAGTCCTCAATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations