Transcript

col2a1a-202

ID
ZDB-TSCRIPT-090929-8520
Name
col2a1a-202
Previous Names
  • col2a1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025812 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025812|OTTDARG00000020587|ZDB-GENE-980526-192 col2a1a|OTTDARP00000021218 col2a1a-001 LG_ BX927144.24 Danio rerio protein_coding KNOWN, 5937 bp
TGACGCGGTGGGTTCTGTCTGTGTGTGCCTGGCGTCGGAT
CCTCCCAAACACATCCACATCCACTTCCACACTCCCCGCG
AGCACTGGGCTGCCGCTCCGCCGGGTCTTCGGCGACTTTC
ACCCCTTAGGACCTGCATGTCTAATCTTTAGACATGTTCA
GATTGCTGGATTCACGGACTCTCCTGCTACTTGTGGCAAC
GCATAGCGTTTTGCTATCGCTTGTAAGATGTCAACAAGAA
GATGACCAGGAAGAGTTTGGCGGCTGTGTTCAAGATGGCC
AGCAGTATGCAGACCGTGCGGTTTGGAAACCAGAACCGTG
CCGTGTCTGCGTGTGTGATTCGGGGACTGTGCTGTGTGAC
GAGGTCATCTGTGAGGATCTGAATGACTGTGCCAATCCCA
TCATTTCACCTGGAGAGTGCTGTCCCATCTGCCCAGCTGA
CACCGACGACCCTATCGGGTCACTTGGTGCAAAGGGACAG
AAAGGAGAACCAGGCGATATTACAGATGTTGTAGGACCAA
GAGGACCTGCTGGACCAATGGGACCCCCGGGAGAGCAGGG
AACACGTGGAGAAAGAGGAGCTAAGGGTGAGAAGGGAAGT
CCCGGCCCAAGAGGGAGAGATGGCGAGCCTGGTACACCTG
GAAACCCAGGACCCCCTGGACCACCCGGACCCAATGGTCC
CCCTGGACTTGGAGGAAACTTTGCTGCTCAGATGGCTGGT
GGTTTTGATGAGAAGGCAGGAGGTGCTCAGATGGGTGTGA
TGCAGGGACCAATGGGTCCAATGGGTCCCCGTGGTCCTCC
TGGCCCCTCTGGAGCACCTGGCCCACAAGGTTTCCAAGGC
AACCCTGGAGAGACTGGTGAACCCGGCCCTGCTGGTGCCC
TTGGACCCCGTGGCCCACCCGGCCCCCCTGGAAAACCCGG
AAGTGATGGTGAGGCTGGCAAACCTGGTAAAGCTGGTGAG
CGTGGACCCCCAGGACCTCAGGGAGCTCGTGGATTCCCTG
GGACCCCTGGACTCCCTGGCATCAAGGGACACAGAGGACA
CCCAGGTCTGGATGGTGCTAAAGGAGAGGCTGGTGCTGCA
GGTGCCAAGGGTGAGGCAGGTTCTAACGGTGAGAGTGGCG
CTCCTGGACCAATGGGTCCTCGTGGTCTGCCCGGTGAGAG
AGGTCGCCCTGGTGCAACTGGTGCTGCTGGTGCCCGTGGT
AATGATGGTCTGCCTGGTCCTGCTGGTCCTCCTGGTCCTG
TTGGTCCTGCTGGTGCTCCAGGTTTCCCAGGATCCCCTGG
ATCTAAGGGTGAAGCTGGTCCCACTGGGGCTCGTGGACCT
GAGGGCGCACAGGGACCTCGTGGAGAGGCTGGTACACCTG
GATCACCTGGACCCGCCGGTGCATCCGGTAACCCTGGTAC
TGATGGTATTCCTGGAGCTAAAGGATCTGCTGGTGCTTCT
GGCATTGCTGGTGCTCCTGGTTTCCCAGGACCACGTGGTC
CACCAGGACCTCAGGGAGCCACTGGACCTCTTGGGCCTAA
AGGACAATCTGGAGACCCTGGTATCCCAGGATTCAAAGGC
GAGGCTGGACCCAAGGGAGAGCGTGGTGTTCTAGGACCTC
AAGGACCTCCTGGGCCATCAGGTGAAGAGGGCAAGAGAGG
ACCAAGAGGAGAGCCTGGTTCTGCCGGACCTCTTGGACCT
CCTGGAGAGAGAGGAGCTCCAGGTAACCGTGGATTCCCTG
GCCAGGATGGACTTGCAGGAGCAAAGGGTGCTCCTGGTGA
TCGTGGTGTTCCAGGTTTGAGTGGACCGAAAGGAGGCACT
GGAGATCCTGGTCGCCCTGGTGAACCTGGTCTTCCTGGAG
CCAGAGGTCTCACTGGACGCCCTGGTGATGCTGGAGCTCA
AGGAAAAGTCGGAGCGACTGGTGCCCCTGGTGAAGATGGC
CGCCCTGGACCACCTGGGCCTCTGGGAGCTCGTGGTCAGC
CTGGAGTGATGGGATTCCCTGGACCCAAGGGAGCCAATGG
TGAACCTGGAAAACCTGGAGAGAAAGGACTTGTTGGACGC
ACTGGTCTTAGAGGTTTGCCTGGTAAAGATGGAGAGACTG
GACCTTCTGGTCCTCCTGGCCCTGTTGGTGCTGTTGGTGA
GAGAGGAGAACAAGGTCAACCTGGTCCATCTGGCTTCCAG
GGTCTGCCTGGACCTACTGGAGCCCCCGGAGAACCTGGTA
AACCTGGTGACCAGGGTGTTCCTGGAGAGGGTGGTGCTGC
CGGTCCCACTGGACCAAGAGGTGAGCGTGGTTTCCCTGGT
GAGAGAGGAGGCGCTGGCCCTCAGGGTCTCCAAGGACCAA
GAGGACTTCCAGGAACTCCCGGAACAGATGGACCCAAGGG
TGCGATTGGGCCAGCTGGTGCTGCTGGAGCTCAAGGTCCT
CCCGGTCTTCAAGGCATGCCTGGTGAGAGAGGAGCTGTTG
GTATCTCTGGAGCTAAAGGTGACAGAGGTGACTCTGGAGA
GAAGGGACCTGAAGGTGCTCCTGGTAAAGATGGTTCAAGA
GGTTTGACTGGTCCAATTGGCCCACCTGGTCCTTCTGGTC
CCAATGGCGCAAAGGGTGAAACTGGTCCTATTGGTTCAAT
TGGTGCTCCTGGTGCTCGTGGTGCCCCTGGTGATCGTGGT
GAGATTGGTGCACCTGGACCTGCTGGCTTTGCTGGACCCC
CTGGTGCTGATGGCCAACCTGGAAATAAGGGAGAGCAGGG
TGAATCAGGACAGAAAGGTGATTCAGGAGCCCCTGGACCC
CAAGGACCATCAGGTGCTCCAGGCCCAGTGGGCCCAACTG
GTGTCACAGGACCTAAGGGAGCACGTGGAGCCCAAGGAGC
CCCTGGTGCCACTGGTTTCCCAGGTGCTGCAGGACGAGTT
GGACCCCCTGGCCCCAACGGTAACCCTGGTGCTGCCGGCC
CAGCAGGTCCTTCTGGTAAGGATGGTCCTAAGGGAGTTCG
TGGTGATGCCGGTCCCCCAGGTAGAGCAGGAGATGCTGGA
CTGCGTGGACCTCCTGGTGCTCCTGGAGAGAAGGGAGAGG
CTGGTGAAGATGGTCCTCCTGGTCCTGATGGTCCTTCCGG
CCCTGCTGGTCTTGCTGGTCAGCGTGGTATTGTTGGTTTG
CCTGGTCAGCGTGGTGAAAGAGGTTTCCCTGGACTTCCAG
GACCTTCTGGTGAGCCTGGCAAACAGGGAGCTCCAGGAGG
CTCTGGTGACCGTGGACCTCCTGGCCCTGTTGGCCCACCT
GGATTGACTGGACCTGCTGGAGAGACTGGCCGTGAGGGTA
ATCCTGGATCTGATGGTCCACCTGGTAGAGATGGTGCTGC
TGGTGTGAAGGGTGAGCGTGGTAACACTGGCCCAATTGGT
GCTCCTGGAGCTCCTGGTGCCCCTGGCGCTCCTGGTTCAG
TTGGTCCAATTGGCAAACAGGGAGACAGAGGAGAGAATGG
CCCACAAGGACCTGCTGGACCCCCTGGACCCGCTGGAGCT
CGAGGCATGGTTGGACCCCAAGGACCTCGTGGTGATAAGG
GTGAGGCAGGAGAAGCTGGAGAAAGAGGCCAGAAGGGACA
CAGAGGATTCACTGGTCTGCAGGGTCTGCCCGGACCTCCC
GGTTCTCCTGGAGACCAGGGTGCTGCTGGACCTGCTGGAC
CTTCTGGTGCTAAAGGACCTTCAGGACCTGTTGGACCTGC
TGGTAAGGATGGTTCTAATGGTCAGCCTGGACCCATTGGT
CCACCTGGACCTCGTGGACGCTCTGGAGAGTCTGGCCCAG
TTGGTCCTCCTGGTAACCCCGGACCCCCTGGTCCTCCTGG
TCCCCCTGGCCCTGGCATTGACATGTCTGCCTTCGCTGGA
TTGTCTCAGCCAGAGAAGGGACCCGATCCTCTGCGTTACA
TGCGTGCAGATGAAGCCTCCAGCTCTCTCAGACAACACGA
TGTGGAGGTGGACGCCACTCTGAAGTCCATCAACGGGCAG
ATTGAGGATATCCGCAGCCCCGATGGCTCCCGCAAGAATC
CTGCACGCTCCTGCCGAGACCTGAAACTCTGCCACCCTGA
ATGGAAGAGCGGTGACTACTGGGTGGATCCCAACCTTGGT
AGCGCTGCTGATGCCATCAAAGTTTTCTGCAACATGGAGA
CCGGAGAGACCTGTGTGAAACCAAGCACTCCTAAAATCCC
ACGCAAGAACTGGTGGACAAGCAAGAGCAAGGCCCAGAAG
CACGTGTGGTTCGGAGAAAGCATGAACGGCGGATTCCACT
TTAGCTATGCTGATGGCAGCCAGACTCCTAGTACTACCAC
CATCCAGCTGAACTTCCTCAGGCTGCTGTCTACTGAGGCC
ACTCAGACCATCACCTACCACTGCAAGAACAGCGTGGCTT
ACATGGACCAAGCCACAGGCAACCTGAAGAAGGCCATTCT
GCTGCAGGGCTCCAATGATGTGGAGATCAGAGCAGAGGGC
AACAGCCGCTTTACATATGGCGTACTTGAGGATGGCTGCA
AGAAGCACACAGGTCAATGGGCCAAGACTGTGATCGAGTA
CAAAACTCAGAAGACATCCAGACTGCCCATCATGGACATC
GCTCCAATGGACATCGGAGGCGCAGATCAGGAGTTCGGAG
TGGACATTGGCGCAGTCTGCTTCTTGTAAAAAGAAATCAA
CTAAAACACATGTGGATTATGAGATAAGACATGGAAAAAT
ACCAATGACGAGCAATAACTGTGAGGATGCAAAACACTCT
CCAAATAACGAAACATGGAAGAAAAGCAAAGAAATCTGAA
AATTGACGAAAGTTTTTTTTCTCTAAAACGCAAAATAAAG
TCGTGCTGTCCGCGTTTAGCGTGACGGAAAAAAACAGCGC
TAAATAGTCTCTCCCTCTGAAATCCAGCCATGTTTCCCAC
AAGTGCAGCGCCTCCTCTTGACGGGAGCCAAGAGGGGGAC
CGAACATGCGAGCACTACCAATGAAAGACAGAAACATGGC
TTGATGTCATCACATCCTGCAGGTGGCGGGTGGGTGGGCC
ATGCTGTACAGTGTCGTGACTGGAACCACAGCAGTCCCTC
CCACTAAAGAAGAAAGAAGGCCAGTCCCACTTCACCCCTT
ACTCTGCCTCTTGACTGTGACTCAGAAGAAAACATCTCAT
TGTGAAATGTTAAAGCTGAGGAGGGAATAAGTTAATATTT
ACTGTGTATAATATCAAAAAAGTCTTGATTCAGTCTGTTC
TGAAGCAGCCAGATCTATATATTTTCACAATTGTATGTGT
TTGTGTGCGAGCATGTGCTTATACACACACAAAACAATAT
TTTGGGGAAAGTGCAGTTCCATTTCTTTCTTTTTTTTGGT
GTAAATCAATATTTTTTTCTCTCCCATGATTGCCCAGAGT
AGAGAGTTTTGGTTCCCTTGACGTAACAGCGAAAATAAAT
ACACGAAAACAAATAAATTTGGAAACCAATTCTAATATTT
GTTTATTTGCATGATCTTCATTCTTCAAGAAAAGCTACCT
CACACAGGAAAAAACAACAACATTAAAATCTGGATGTGAA
CGGAAGCAGCCTGAGGTTCTCGTAACATCAGGATGACACC
CCGGTGCGGCTTGGTCCATCTTCAGAAGGTGCTATTAGTT
TTGATCTAACTGTCAGTATTTCCCAGAATTCCCAATCCAT
CCCACTCCCTAACTAGCCTCATTGGACACACACAGCCTGC
TCGGAGGATGCGGAAACTGTTGCTGGATGATCAAAAGACA
GAGGAACTCTTTTGGCATTGCCAGAATTTTGCTCCCAAAG
GATTGCCGTAGCGCTGAGCAGGATGTGTGTGTGAGTGAGG
GTGTGTATATTTTTGTTATAATTAATATTATTATGATCTT
GGTCTTTTTTTTTGTTTGTTCTCTCTTTTTGGTTCTGGTT
TTGTTACGATTTTAATTAATGTAAATTGAAAATAAAGGAA
AAAACAAGGAATTATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations