Transcript

shbg-201

ID
ZDB-TSCRIPT-090929-8496
Name
shbg-201
Previous Names
  • shbg-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025781 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025781|OTTDARG00000020570|ZDB-GENE-030131-1324 shbg|OTTDARP00000021195 shbg-001 LG_ AL929346.6 Danio rerio protein_coding KNOWN, 1573 bp
TTTGACTGGAGTTTACTCACTTCTCATGGGTCAGAGAGAG
AGAGAGAGAGAGAGAAAGGTGGTCAGACGGCAGTTGGCTC
AAACAAGGCGTCCAGCTTGATTTCATTCATTCTAATCTCT
GGAGGTAAAGAAAATGAAATATCTCAAGGAAGTGATCATC
TTGTTGTTATGCCCATGCCTGATTCTTCTGTGCAGGAGAG
CAGCAGGTGATCAAATATCCGGCAGGGGAACCATCAATCT
TGCACACAGACAACAAAAATGGACACCTGCGATGCAAACA
TGTGCAAACCTCTCTGACATCAGGAGCATCAGATCTTTCT
TTGAGTTTCGAACCCTTGACCCGGAGGGAGCTGTCTTTTA
TGGAGACACTAAAGAAGGTCAAGATTGGTTTGTGCTTTCA
CTGCGTGATGGCATCCCTGAAATGCAGATTGGGAAAGCAG
ACATCTTAGTGAGTGTAAAGGGAGGTCGCAAACTCAATGA
TGGAGCCTGGCATTTGTTGGAATTGCGCAGTGAAGGTAAA
TTTGTGGTACTGGAGGTAAACAACGAGGTAGAACTTGTAG
TGGGACTTCATTCGAAACTGGCAGAAGAACAACTAACAGG
GAAGATACGTCTGGCTCTCGGTGGCATGTTGGTGGACAAA
CAAAAACTCTTCCATCCTTTTGAGCCAGAAATGGATGCGT
GTATCAGAGGAGGGCATTGGCTGAATCTCAGCACCCCCTG
GGATACAGACTCAACATGGGAACCTCGGCCATGCTCTTCA
GAAATCAAGAAAGGGAGCTATTTTCCAGGAACTGGAGTGG
CTGTGTTTAATACATCTGATCTTCCTGCTCTTAAGACTGA
AGAGGCCGGAATCACAGTAGAGATCTTTGGATCTTGGATT
GGGACAACACTAAGTCTCCAAAGCACAGGATTTTTGTATG
TTTTAGAAGGGGATAAAGATGATAAGTTGGGCCTGAAAGA
TGGATCAACCGAATTTCCCAGTGAACCTGCAACACTTACT
TTCACTATACTGAAAAATTCACTTGTGGTAAACAGCAAAC
CAAAGGTTAAATCGGAAACTCTGGACTTTCTCTCCATGTG
GAAAAATGGGATGCTCCTGACATTTGGGGGAGTGCCAGGT
GACAGCGAGGTGGCAAAAAGTAATCCATACCTGCGTGGGT
GTCTGGAGAAAATCGTTGTCCAGGGTCAGGTCATTGATCT
TGATCGGGCAGCGTACAAACACACAGCGGTGTCGTCCCAC
AGCTGTCCTACAGAAGCAATGAATGAACTCACTTTGTAGA
GATTTAACACAATCATCCCGACAGGCTCAACTCTTGATCA
AATCAGGAAGGGCTATTTAAAACTGCTAAATTTTTAGTCA
GTCATTATAACCTCCAAAATGTATTAATAAACAATATAAA
AATTATTAAATGTCAATTATGTTACACTGAGCATTAAAAT
ATGTTTAAAAACGACAGAACATTAAACACTGTAATGAAAA
TTCTTCTGAAATGTGTTTGCAAACACATATAAAAGCAAAT
GTTTTTTTTAATGACCATATTTCAGAGAACAAAATAAATC
AGCTGCAATCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations