Transcript

pth1rb-201

ID
ZDB-TSCRIPT-090929-8423
Name
pth1rb-201
Previous Names
  • pth1rb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025705 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025705|OTTDARG00000020517|ZDB-GENE-991123-12 pth1rb|OTTDARP00000021130 pthr3-001 LG_none CR456631.7,CR457459.9 Danio rerio protein_coding KNOWN, 2143 bp
TTACACCACTAACCTCACAGGAGATCACATCTCTGGACAC
ATCTCCACAAGTCTCTCTTTAAAACATCTACAATTGGACT
GACAAATCTCTTCTTTAATCAAGGATCTGAGTTAATACAA
AAAAAAATCTGATGAATGGAAGAAAATCATCTGTGATGGT
ATTCCAGAAGTTAAAATCTCAACAAAAACAAACAACGGGT
CGGACTTCAACAGATGTGTGTCCGCTTGACACGGCAGCAT
CAGAAAGAAACAACATCTTTAACACAATGAAGAAGTAATG
GCTGCAAACGTCTGCGCTTCTCTCCACATCGACGCGACTG
CCATGTCCTGAAGAGAAACAGGAGCTCTCTGGAGAGCAGG
AGTTCTGGAAAAGGTCAAAGGTCTTGGGTTAAGCATGGTG
TCAGTGGAGGTCTCTGTGGCTTTAGTGCTGTGCTGTGTTT
TGATGGGAGCCAGAGCTCTGATTGATTCAGATGATGTCAT
CACAAGAGATGAACAGATCTTTCTCCTCATTGGTGCGCGG
TCGAGGTGTGAGAGAACCATCCGTGCACAGTCAGACGTGG
TCAGAGAGAATAACTGCGCTCCTGAGTGGGATGGGATCAT
TTGCTGGCCCACAGGAAAACCCAATCAGATGGTGGCAGTT
CTGTGTCCTGAGTACATCTATGACTTCAACCACAGAGGAT
ACGCGTATCGACACTGTGATGCATCAGGTAACTGGGAGCA
GGTGTCCATTATAAACCGGACGTGGGCAAACTACACGGAA
TGCACCACTTACCTGCACACCAACCACAGTGATCAGGAGG
AAGTGTTTGAGCGCCTTTACCTCATGTACACTATTGGATA
CTCCATATCACTGGCAGCGTTACTGGTGGCGGTCTCTATC
CTTTGCTATTTCAAACGTCTCCACTGCACTCGTAACTACA
TCCACATCCACCTCTTCACCTCGTTCATATGTCGAGCAAT
CAGTATTTTTGTGAAAGACGCCGTTCTTTACGCCGTCACG
AATGATGGAGAACTAGAAGATGGGGCAGTGGAACAAAGAC
CCATGGTGGGCTGCAAGGCTGCTGTGACCCTCTTCCTGTA
TCTGTTGGCGACCAATCATTATTGGATCCTGGTGGAGGGT
TTGTACTTGCATAGTCTGATCTTCATGGCCTTCCTGTCTG
ATAAGAACTGCCTGTGGGCTTTAACAATCATAGGCTGGGG
GATCCCAGCAGTGTTTGTGTCTATATGGGTCAGTGCCAGG
GTGTCTCTGGCAGACACACAGTGCTGGGATATCAGCGCAG
GCAATCTAAAATGGATCTATCAAGTACCAATCCTGGCAGC
CATTGTTGTAAACTTCTTCCTCTTCCTCAATATCATCAGG
GTTTTGGCCTCTAAGTTGTGGGAAACAAACACGGGAAAAC
TGGACCCTAGACAGCAGTACAGGAAGCTGCTGAAGTCAAC
AATGGTGCTGATGCCACTGTTTGGAGTTCATTACATGCTG
TTCATGGCTCTTCCGTACACTGATGTGACTGGTTTGCTGT
GGCAGATTCAGATGCATTACGAGATGCTCTTCAATTCTTC
ACAGGGTTTCTTTGTGGCGTTTATTTACTGCTTCTGCAAT
GGGGAGGTGCAGGCAGAGGTGAAGAAGGCCTGGTTGCGAC
GCAGTCTTGCGTTAGACCTGAAGCAGAAGGCTCGAGTCCA
CAGCAGTGCGGGATGTGGAAGTGGTTACTATGGAGGAATG
ATGTCCCACACCACCACACAGAGCGTGTGTCTCAGTGTCA
GTGGTGCTAAAGGCGGTCATTCTCTGCACACCATAGGAGC
CAAAGGACAATCCCGTCTACAACATTCAGGAAACTTACCC
GGCTACGCGCCTCAGGACACAGAGACTTTGTTTTACCCAG
TGGTCCCAAAGCAGAAAGAGACTCCATGCAGACAGAGCAG
CAGGAATGCAGAGGAAAGCGAGCATGATTTTGAGCCATAT
TTCGTAGCGGATGAGGAACATTCTGGATCCATGTCTTGGA
AAGAACTAGAAACGATGCTTTGATGTAACTTGCTGGATAT
TATAAGTGGTGCTTGCTATTGTCAGAAGTTCTAAGTTATA
AAAGCTTGTTTTTTTTGCCACAGAATACAAAACATTACAA
TAATAATTGTAGCTTTTTATCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations