Transcript

lgi3-201

ID
ZDB-TSCRIPT-090929-8401
Name
lgi3-201
Previous Names
  • lgi3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025683 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025683|OTTDARG00000011731|ZDB-GENE-060217-4 lgi3|OTTDARP00000021112 lgi3-002 LG_ BX247873.15 Danio rerio protein_coding KNOWN, 1769 bp
GATCTTCTGCTATTGAGGTTTGCTTGATAAGGATTGGATA
CTAAACAGCCTTGTTCAACCGTGTAGATTGAAACAACTCC
AGCAGGAGACGAGAAGAAGCTGGAAGATGGTGGAAGCGAG
GCCCAGACGGACTCTACGATGGCCAGATTGGAGGTGGTCT
GTTTGCGTGCTGCTCTTCTGTATGTTTGGGACGGCACCGG
GCCGCAAAGCCCCTAAAAGCCCACGGTGTCCAGCCACCTG
CTCCTGTACTAAAGACAGCGCCTTCTGCGTGGACACCAAA
GTCATTCCTAAGAGCTTCCCGACGGGAATCATCTCTCTGA
CTATGGTGAACGCCGCCTTCACAGAGATTCCCGAAGGAGC
TTTTTCCCACATGCACCTGCTGCAGTTCCTGCTGTTGAAC
TCAAACACTTTCTCTGTGATCTCTGATGATGCCTTTTCTG
GTCTTGGACACCTGCAGTATTTATTTATCGAGAACAACGA
CATCCAGGCGCTGTCAAAGCACACATTCAGAGGACTCAAG
TCACTGACACACCTGTCCCTGTCCAATAACAACCTGCAGG
TTCTTCCCAGGGAGCTCTTCAAGCACCTAGACATCCTTAC
AGACCTAGACCTGCGCGGGAACTCGTTTCGTTGTGACTGC
AAGATCAAATGGCTGGTTGACTGGATGGAGAAAACCAACA
CGTCTGTTCCGCCCATTTACTGCGCCAGTCCGTTTGAGTT
CCAGGGCCGACGCATCCATGAGCTCACACCGCGAGACTTC
AACTGCATCAGCGCAGATTTCGCAGTTTACGAGACCTACT
CGTTCCAGTCTCTGTCCGTGGAGTCGTACGAGTTTCAAGA
TGACCAGTATGTGGTTTTCGCTCAGCCCAACACTGGAATC
TGCACCGTCTTCATTTGGGATCACGTCAACATGCTTTTCA
AGACACATTACAACATCACGTCTCGTTCTGCTGTCTACTG
TAAACCTGTGGTTATCAACAACACTCTCTACATGGTTGTG
GCGCAGCTCTTTGGAGGATCCCACATCTACAAATGGGAGG
ATGGTCCATTGCGATTTGTCAAAATCCAGGACATCGACAC
CACCCGAGTCCGAAAACCCAACTTCATCGAGACTTTCCAG
ATTGAAGGAGACTGGTATTTTGCAGTAGTCGACAGCTCCA
AAGCCGGTTCCACCAGCCTGTACCGCTGGAACAGCAACGG
GTTTTACTCACACCAGTCCCTCCATCCCTGGCACAGAGAC
ACTCACATTGATTTCCTGGAGGTGGACGGCAAACCTCGCC
TCATCCTCTCCAGCGCCTCGCAGCCCCCGGTGGTTTACCA
GTGGAACCGCAGCCAGCGCCAGTTCGTTTTCCACTCTCAG
ATCACCGATTCGGGCGACGTTCAGATGGTCAAGCACTTCT
GGGTGCGGAAAGTGCTGTATTTGTGCCTCACACGCTTCAT
CGGAGACTCCAAGATCCTGCGCTGGGACAACCAACGCTTT
GTGGAGATCCAAACCCTGCCATCTAGGGGCTCAATGGCCG
TGTATCCCTTCAGCGTCGGAGTGAGGCTTTACCTCCTGCT
GGGCAGCGATTATTCCTTCTCCAGGATTTACCTGTGGGAC
GAGCTCACCCAGCGCTTCCTGCCCTTCCAGGAGCTCAACA
TGCTGGCACCTCGAGGATTCGCCATGGTCTCAGTGGACAA
TAAGGATATTCTGCTGGCGGCCAGTTTTAAAGGGAAGACC
ATGGCGTATCAGCATCTAATAGTGGATCTCAGTGCCAAAT
AGGAGGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations