Transcript

disp2-201

ID
ZDB-TSCRIPT-090929-8347
Name
disp2-201
Previous Names
  • disp2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025626 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025626|OTTDARG00000020476|ZDB-GENE-030915-1 disp2|OTTDARP00000021069 disp2-001 LG_ BX571712.14 Danio rerio protein_coding KNOWN, 4581 bp
ACACACACACACAAACGCAAACACGCACACACACATTCGC
TAAAGCAGAGCTGCCTTCAACACCAACACAACCCCGCTTC
CACTGCATCCCTGCACACAATTACACATCTGACCCCAATA
TTAAACATACTCCAGCATGGAAAGCGGGTCCATTTCCAGA
CAGCGCGAGGATGCTGAAATGCCAGATTCATCCACGACCG
AGGGACCTTCTCTGGAAGCACCTCAAAGTGAGATCCCTGA
AGTTTCGTTGTGTCCTCCAGACAGTGACAGCACAGAATCT
CAGATGTGTCCGGTCGAGATAGAGGAAAACCAAACTAAGA
GCAGCAGTCCCTTCAACTCACACTCCTCGACTCAACTCGA
GCGTCAAGTGTCACAGGGCTCTGCCTATCATTCACCACCA
CACAAAAAATGCCCCTGCTGTGGCCACCAGCAGCCCAGTC
AAAGCGATGTCTGTCCGGGTCAAATGAATGCGCTCCATCA
AGCAGACTGTGCAGCAAGTCCTGTTAAGACTCTCTATAGC
TGCAGTCCATCGCGCCTGCCTTCGTGTCATACTAAAATGC
AGTGCCACTGGCTTCATGGATCTCATGATGGCAGCAACCA
CAAGCCTGTACAGCATCACATGGTGACAGTGAGGAATGAT
GGTCTGCACAGGATACCAAGGAGCTATTCCCAGGTCATAG
TGGAGTACCCAATGACTGTACTCATCTCATGTACGCTGGT
TCTGTTTGCTTGTTCTCTCGCTGGGATCTTGACTGGTCCT
CTTCCAGACTTTTCAGACCCATTGTTGGGATTTGAACCAC
GTGGAACAGACATCAGTGTTCGACTAGCAACCTGGACGAG
GCTAAAGCAAAACACTGGGCCTGGAAAGCCACTGTCCCCA
GTTCCATGGCAGCTCACAGAAAAAACTACAACAGGAAAGG
ACACAATTAAATCTGAACCTCAGTTCAGAGAGCGATCGAG
AAGAATGCTGCACAGAGATAACGCGGAGCACAATTTTTTT
TGTAATGCCCCAGGAGAGCGCTATGCTCAGCTGGTCTTCC
GCTCTGGAAACTCTGCCAGTCTCTGGAGTCTAAAGGCTAT
TTACTCCATGTGCCAGATGGAACAGACACAGATCCGTTCA
GGACCACAGTTTGATAAACTTTGCCAGGTCAAATCAGAGT
TCTACGGCTCCATGGTGAAGAATGAGTGCTGTCCAAGTTG
GTCCTTGGGAAACTACTTGGCTGTCCTCAACAACATTTCT
TCCTGCTTTAGTCTGACTTCACAACAGGTCTCTGAAAGCC
TTGGCCTGCTCAGATTCTGTGCCCCTTACTACCACGATGG
AAGCCTGATTGCATCTTGCACTGAGAGGAGTAAGTTTGGC
CGCTGTGCATCCGTCCCACATCGATGTAAACTATCAAGCA
TCTTCCAGATCCTCCATTACCTAGTGGACAAAGACTTCCT
AGGGCCACAGACTGTTGAATACAAGGTCCCATCCCTAAAA
TACAGCATTGTATTTCTACCAGTGGAAAAGAGTGATTCAT
TGATGAACATTTATTTGGACCATCTAGAAGGTCACAAGCT
CACATACAACAACACCACCATTACAGGAATGGATTTGGGG
ATTAAACAAAAACTTTTCAAGTATTACTTGGCAAGGGACT
CCATCTATCCTGTTCTTGCAGCTCTTGCACTTTTAATCAC
AATTGGACTGTATCTGAAATCACTATTTATAGCAGCGATG
TCACTGGTTGCTGTCATATTATCACTTTCCACCTCATATT
TTTTCTACAAAGTTGCATTCCGCTTGACATTTTTTCCACT
TCTCAATCTTGCAGCAGTCTTTGTGCTTTTGGGGAGTTGT
CTAAATCAAGCCTTAACTTTCGTTGACTTCTGGAAACTAC
AGCTAAGCCACAACCCTCCAGCTGTACCCGAGAAAAGAAT
GAACCGCGTTTTACAGGAAATGGGATACTTGATAATAGTG
TCAGGTCTGACATCTAGCGTCACATTTTACTCGGGCTACA
TAAGCAGCATCACTGCCGTCAGATGCTACGCTGTTTATCT
TGGCAGCGCCTCATTAATCAACACATTGTTTGCTCTCGTT
TGGCTTCCGTGCACTCTGATTTTGCAAGAACGCTATGCTG
TACTGTCTTCAAATACTGTCGGAAAAGTGGCATGGAAGCC
CTGTTGCTCAAAAAATGCGGGTGGATTCTGGGAGACAAGT
TCAAGAAAGCGTTGTCTGTTTACCTTTAGACAAAAGCTTC
GGACACTGGGTCGAGGGTTTTCAGACACATCAAACCTACT
GTTTTTAAAGATCCTGCCTTGTGGAGTGGTGAAATTCCGA
TATATATGGATTTGTTGGTTTGCTGTGCTTGCAGCCGGTG
GAACATACATATCATGTGTTGATCCTGGCATGAAACTGCC
AACTTCAGACAGCAGGACAACTCAGCTGTTCCGTTCAAGC
CATCCCTTTGAGAGATACGATGCTGAATATCGCCACCAGT
TCATGTTTGAGCGAATGAAAGACGGCGAAGATGAACCCAT
GATGCTGACTTTAATTTGGGGCATTGTCCCATCAGACAAT
GGAGACCACTTTGATCCAAAAAGTAATGGATCTTTATCTG
TTGATCCAGGGTTCAATATGAGCAGTCTACAAGCCCAGAT
ATGGTTGCGAGATCTATGTGGAAAAATTCAAAACCAGACC
TTCTATTCTCCATTGTCAGCTGAACAAGACACAGCAGAAG
ACAACGTGTGTTTTGTTGAACATCTGATACACTGGGTTTC
CATACGTCGCTGTTCAGAAAGCGAGGATGCATTTAGCTTC
TGCTGCAATAATATTCCCTTTCCTTACCCACCAAGGGTTT
TTGAGCAGTGCCTTAGCATGATGGTGGCGGAGCAGCATGC
AGAAGGGCGCTTACCCAGTGCTGGAGGCTTACGGTTTGAT
TCAGAGGGTCGAATCGCTGCTCTTGTGGTAATATTCAAGA
CTGTTCAACTTTATAGCTTCAACTACAACAGAATGTCACA
GTTTTACCAAGAGATCTTATCCTGGTTTAATAGGGAAATC
TCTAAAGCTCCAGCTGGACTTCAGAGAGGATGGTTTGTAA
GTCAGCTAGGCTTATATGATCTCCAGCAATGCTTGAGTTC
TGAGACTCTGGAGGTGGCGGGTTTTTCAGTAGCTCTAACA
TTTGCACTGCTCTTACTTACAACGTGGAATATTCCATTAA
GTGTGTACGTGTCCATTGCGGTGGCAGGAAGTGTGTTTGC
TACTGTTGGTCTCCTTGTGCTTTTAGAATGGCAGTTAAAT
GGTGTGGAAGCACTCTTCATTTCAGCAGCCGCAGGTCTCT
CTGTTGACTTTGTAGCCAATTATTGCATTTCATACAGCCT
GGCCCCACACAGCGACAGACTTGGCAGAGTTGCACATTCA
ATCAAGAGAATGGGTTGCCCGGTAGCTACAGGTGCTGGGG
CGTATTTTTGTGTGGGCATTATTATGTTACCGGCAACTGC
ATTGCTTTTTAGAAAGCTTGGGATCTTCCTCCTGCTCGTA
AAGTGTGTTGCTTGTGGCTTTGCTACGTTCTTCTTCCAGT
CGCTGTGCTGCTTCTTTGGCCCCCAGAATAACTGTGGGAG
AATAACCCTACCCTGTGTTACACAGCAGTCCACTGAAAAT
ATACTGTCATCCTGTTCAGCAACAGAACCTGGGACCAACA
ATCCTGCAGCTAATGGGGCATTCGGCTGTGGCAAAGGTTC
TCGGGTTCGAAGAAGTTTCAATAAAGAAAATGAAGGCTTC
CTTTGCCCTAATCAACAGCACCACAGAAAGAGGCAACCAG
TCGGAGGACGGGAACCAGAACAGAATGAGCTTCAGCCACT
CGCTTGCCAGTTGAGTGACAGCTTCGAGAACAGCACTTGC
ACCAGCAAGCTGTCCAACAGACCTTCTGTCCTTTCTGATG
ACATTCAATTCTGTGGCCTTAGTCCAAAGCAAGACTATGA
TCGAGTCAGCATTGAGGCTGACAGCACAGAAATGTGTAGC
AGGCACCTTAAGGGATGCAACCCACCTCCAGCGCTCCAGA
CCTCATCCCCGTACAAAGAGAACATGTTGCGTCTTCCACA
AGATGCATGTAAAGAGAAGGTTTTGTGCAAGAAATGCAGA
GGTCAGTCAAGAGGTGGGCTTCAACTTTGGAACGTGTCTC
TATCGTCTTCCTCTAGTATGGATGAAATCATGATAACTCA
GACTACAGACACTGTCAATGAAAGGTCACTCTCAATGGAT
GACCATATACACAAACGACTGTTGTCATGTCAGTCTCAAA
GCTCCATAGAGGGACTCGAAGAATCCAATGACACTTGCTT
AACTGAGGTAGAAGCGGCTATTCCTCAAGCTGGTAAGATC
GAGGATGAATTTCAACCTGGCCACCTTAATGGCAAGAGGG
ATACTTTACGTCTGTCCTTGAAGGAGACTGTATATGACCT
TGCATCTCCAGGGTCTGGTAGGGTGAGGACAGCTCAAAGT
GATGTGCCAGTGATACTGCCCAACAGCAAACCCGATATGC
CTGATGTCTGGATAAAAAGGGAAGGAAAAGGTGAAGGTGG
CAGCTGATCAATATTGTCAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations