Transcript

rfng-202

ID
ZDB-TSCRIPT-090929-8341
Name
rfng-202
Previous Names
  • rfng-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025620 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025620|OTTDARG00000020473|ZDB-GENE-030131-5418 rfng|OTTDARP00000021064 rfng-001 LG_ BX548040.19 Danio rerio protein_coding KNOWN, 3762 bp
TTCAAAACGTGCGTCTTTGGCATCAACAGAAAGGACAATG
TAGTTGTTGGATATATATTTGGCAACGCGCAGACGCAGAG
GTCATTATAAACAACCCAAGACAGCAGAGATGATGCACAA
CTGAACAACAGAGAGTTTGAGCTGCTGAAACCAAAGATAT
GCGTGAAACTTTATAATAAACAGCGGAAACTGACTGAACA
TATGAGCTCCAGAAGCAGAAGAAGTCAAGCAGGAACAATA
AGGCTTGTGTGATTCATGCTGATTTCTACTCGACGAAAAG
CTGCTGAAATCACCGACCCAGCCTTCGCCTGCGGATTATT
TCAGCCTAGCATGATCTATACTGATTTCTGTGGTTTCACC
GGTTTAAAAGTCTGGAAAATGAGGAGTATATTGACCCGAA
ACCAGTCCGACCGCTCTCGAATGATGCACTGAAGATGGGC
TCTGCAGCAGTGAGTCAGGCAGGCGCGGGCGGTTGAGCTG
GCGTTCAGCATTGGAAGAATGCACTTATCCCATGTCGGCT
CCAACAAAACCTGCTTTCTGCTTTCCCTCGCATTCTGTGC
CCTGCTGGTGCTGCTTATTCCCTCCTTACAACCTCCACAG
CGTCAGGCGGATCTGCCTCAGCCGCGGCCCCATGCCAAAC
CCGCCAAACACCCACTCAAAAACTCTCTCTACAGACCAAA
TGAAGACACCAGGGGTGGTAGTTTTACTCAAACAACTCCA
CCTGAGAACCTGCAGAAGATGGACGATCTAAACTCGCACT
ACAGAGACTTCCTGGACTTAAGAGACATTTTTATTGCTGT
GAAGACCACTAGGAAGTATCACAAGTCCAGATTGCAGCTC
CTGTCCCAGACCTGGGTGTCCAGAGCGAAGGAGCAGACGT
TTATCTTCACTGATGGGGAGGACAAGGAGCTCCGGCTGAA
AGCAGGGCTGAACATCATCAACACCAACTGCTCGGCGGCT
CACACACGCCAAGCCCTGTGCTGCAAGATGTCTGTGGAGT
ATGACAAGTTCATCGAGTCACAGAAAAAGTGGTTTTGTCA
TGTGGATGATGATAACTATGTGATCCTGCCCAGTCTACTG
GAGCTTCTGTCCTCGTACTCTCACACACAGGATGTGTATC
TGGGCCGGCCTAGCCTGGATCATCCTATAGAGGCTGCAGA
GAGAGTCAAGAGCGACGGATCGGTGTCAGTGAAGTTCTGG
TTTGCCACTGGTGGAGCTGGTTTCTGCATCAGTCGAGGTT
TAGCGCTCAAAATGAGTCCATGGGCCAGTCTTGGAAACTT
TATCACAACAGCAGAGAAGATCCGTCTGCCAGATGACTGT
ACAATTGGCTACATCATCGAGGCGCTGCTGGAGGTTCCTC
TCACCCACACAGGCCTGTTTCACTCACACCTGGAGAACCT
GCAGAGACTGCCTGCAGAAAACATCCTGCGACAGGTGACC
CTCAGTTATGGTGGATTCGAGAACAGGAGGAATGTGGTCA
GTGTTGGAGGAGCGTTTTCATTGGCTGAAGACCCAACACG
GTTTAAAACGGTTCACTGCAAGCTCTACCCAGACACCGAG
TGGTGCCCACGCAAGACTCGCCATTGACGTCTGGTATACG
AATGCATCATCATGGAGCATCAACTTTCTCATGCTTTCCA
CAACACTATCTATACCAAAGGAACAGGCAGAATAACTGAG
CACAGATTGTGATGGTTGCAAATAAGAAACGCTAGTTAGA
TCACATTCACAGACTACAGTATGTTGTATCTCCTTTGCCA
GAACAAAAATCTAAACAATCTTAAACCAACATACATTTAC
TTAAGCAGAAGAAGAACATATCTCAAAGTGTCTTTCAGTT
GGTTTTCATTTATAAACATTGATGTTTTCTCCTGTTTTTA
ACACAAACTTATGATTGAAGTGATGTGCTGCTCATGTAAA
TGTATGGGGATTTAAGATTTGTGGTATTTTTATAATGGGA
GACAAGACTAATATTGAGCAAGAAAATGTTTTTTCATTGT
ATCTGGTACTTTTAAATGAAGAAACAGGGTGGCTGACACT
CTTTTTCCTCTTGAAATACTGCGTTCTGAGAACTGCCAAG
TGATTTACATAAAGCGAGTCCCTTTCATAAGAGCGTTTCG
AAAGGATTGCGCAATTATTTTCTTACTGAAATGATTTTAT
CCACATTTTTTGTGGCTTTGACATCATCTTTATTGAGTTG
TCCTTTTCCTAAAGGCCATAAATATGCCCAGCACAGCCCT
TTAGATTTGTGTGCGATGATCTGCAACGTCTCCAGGGATG
AAGAAAACTGTATTGATGCATCATCTTAGCATTTTGTTTG
CAAGATTTATGCAGGCCAGCTCATCTGCTGCCAATGTTTC
TCAGCATGTTCTTCTCGGTTTGTGTTTTGTGTATCCAGAA
GGCCATTTGCACTCGGTATGCCTCTAGATTTATAGGTTGC
CGTTAAGTATTAAGGGAATAGTTTAATACACAAAACGAAA
AATGCACTCACTTTCAAGTGGTGTCAAACCTTTTTGGGTT
TCTTTTGTCTTTCTGTTGAACATAAAAGAATGCTGAAAAC
CTGTAACCATTGACATTCATAGTAGATTAGAAAATACAGT
GGAAGTCAATGTTTAAAGCATTCTTCGAAGTATCTCCTTT
AGTGTTCAACAGAAGAAAGTCAAACAGGTTTGGAACAGAT
GCTGAAACAACACAATTGTGGAGGTTTTTTTGGGACAACT
TAATTGTTTTATGTTCAATCCACTTCAGTTTATTAAGCTT
AATTGATTTGTGTGTGATGATCTGGATGAAGAAAACGGTA
ATGATGCAAGGTTTGTGCAGGCCAGCTCATCCACTGCCAA
TGTTTCTCAGCATGTTCTTCTCTGTTTAAGTTTTGTGTAT
TCAGAAGGACATTTGCACTCCGTATGTCTCTAGATTTATA
GGTTGGCATCAAGTATTAAAGGACTAGTGCATTTTTCATT
ATGGGTATTAAACCATTTACTCACTTTCAAGTGGTTTTAA
ACCTTTATGAGTTTGTTTTGTTTTTCTGTTACATGAAAGA
AGATATTTTGAAGAATGCTGAAAGCCTGAAACCATTGACA
TTCATAGTACATTAAAAATACTGGAAGTCAATGATTCAAG
CATTCTTCAAAATATCTCCTTTTGTGTTCAGCAGAGGAAA
GTCAAACAGGTTTGGAACAAGTACACTTAAAACGCTTGTT
CAGTCTACTTACTTAATATGAGCTGAAAACAATTCTGTTG
GCTTTTTTTAGGATAACCCAATTGTTTTACGTTCAGTCCA
CTTAAATTTATCAAGCTTAATTGATTTGTGTTGGGACAAC
ATGAATGAATTGTGTGGAGCCCTGCAGTGTAAAATGTGTG
TAAATAATTTGAAGTTTTGGCTAAACTATCCCTTTAAGAC
TGAATTGAAGATATACAAACCAAAAAGCATTGGTCCAGAT
CTTGCTAATTCCTCCATTTGCTTTTTGTGGTTCCTATTAA
AATGTTTTAACATTGAGTTATTTCCATTGAAAGATTAAAA
ACAAGTGTTCATGTTCCTTCTGATATTTGCACAAACACGT
TCCTCACTGCAGGCCAGTGGTTTGCGTGAACATGCCAAAA
CGATCTCTTTTTCCTAATGTTCTCTGAACGTGCCTGCTCT
CCGTTGACACTACCAAATGCTGTTATTGACTGTTCTTTTT
GTTTTGCTCCTCTTTTTGTTGGTGTTTTTTTTTTGATAAG
GTTGTATGATTTTGATTTTAATAAATTTATTTATTATGCA
GA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations