header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8315
Transcript Name: pla1a-002
Previous Names: pla1a-002, ottdart00000025589

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: variant
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025589 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025589|OTTDARG00000020455|ZDB-GENE-030131-5949 pla1a|no_translation RP71-68N21.1-002 LG_ BX511129.15 Danio rerio polymorphic_pseudogene none, 3370 bp
TGCTGACATGGTCAATAAAAGCACACCGGGAATGGAAGGA
AAGGCCCTTCATCTTGCTTAATCGGATATTGTTGCATTTT
TCTCATAACCAGGCATTGTGTAACAGATTTTGGTGGCTAA
TAAGTGGATTCCAGGCTTCTTAGGTTTTCTAGTTGAAGAA
CAGGAGCAAAATATTTGGTAAGAATGATTTTGCACCCGAA
CAAGAAACATCAGATTTCATACAGTTGATCAAGAAAATCA
TGGCTTGGAAATGGATCAAGGCATTTGTTTATTTGTCGGT
GTGTGTCACTTCAGCTCTGGGTGATGATGAGGAAGCGTCT
GCAAGCAAGTGTGCAGACTTCAACAACACCACCTGGCTGG
AATACAGACAGGCCACCAAGCTTCAGGTTTAGTACCTTCT
GTTGACCCGAAAGAATGCCAACTGTGCCAGTCTGTTCACA
CAAGACTGCCTTAACCACACCCAGAAACACACTGCTTACT
TCAACTCGTCACTGCCCACCAAAGTCATTGTTCATGGATA
CAGGGCTCTAGGCAGTAAACCGTCCTGGGTGAGTGGTTTA
GCTCAGGCTCTACTGAGAGAAGAGGATGTGAATGTTCTGG
TGGTGGACTGGGTCTATGGAGCCTCCTTTGCTTATAACTT
GGTGGTGGAGAACTACAAGGAAGTGGCAATTCAGATATCG
GTGCTTATTAATCAGCTTACGAAATATGGAAGCACGCTGG
AATCATTTCACTTTATTGGTGTGAGTCTTGGAGCACACGT
GTCTGGATTCGTGGGGACCTTATTTCATGGCAAGCTGGGT
CGAATCACAGGTTTGGATCCAGCAGGCCCGATGTTTAAGA
GTGCTGATCCGTTTGACCGTTTGGATTCATCTGATGCCTT
ATTTGTTGAGGCCATTCACACTGATTCTGACTATTTTGGG
ATATCCATTCCTGTTGGGCATGTGGACTTCTTCTTAAATG
GAGGAATGGATCAAGCTGGATGTGCTCGCTCAAGGTTTGC
ATCAATGTATGGGTATGTCATTTGTGACCACATGAGGGCT
CTGCACGTCTACATGAGTGCCCTGAACGGCTCCTGTCCAC
TCATTGGTTTTCCCTGCTCCGGTTATGAGGAGTTTCTGGC
AGGAAAATGCATCACCTGTGACGACCCCTTCAATGGCACG
TGCCCACAGATAGGCTTGTTGAAGAACAGTGGGATAACAG
CGACTCCCCTGCCAAATCAAGAGAAGGTTTATCTGCTGAC
CACTGCTTCAGGTCCATTCTGTGCACATCACATCCTTGTG
GAGTTAAACGTTTCCCGTTTAGACAAAACTGCAGAGGTTC
AGCTCATTCTGAAATCCATTGGACATCCTGAGACGGAGCT
CAATCTCAAACTATATACAGACGAAACAAGGTATAAAACG
GTGGCTGCACACCCTGAGCAGCTGTGTAAAATTGACTCAA
TGCAGCTGATAAACACTGGAGGTCGATTCTACAGACAAGG
AGACATTCATTTTGAGTATATTTGCATCTCTGAAATCCCT
CAAACCAGAGGGATGGATCCACTATGTGTAAAGAACATTC
ATATTGGACGTGGAGTACCATGGTCACATGACTTTGTACA
GGTGTGCTAAATTAAAAAAACAACAGCATAAAATCTGCTT
TGAAGAGCATCTGCATTAACCAGCTTTTCAAGTCTTAAAT
TAGTTAAACTCTAAGCAAAGGTCACACACTTACACTTGGG
CTGGGAAGCATTAAAGTTCTGCAACAAAGACTTAAACAGG
ATACAAGGGGACTGAAATGATTCAGTGTTAGATTTATTTA
TTGTGTTTTCACAAAATGACACATTTAGCCCTAATATAAT
ATCAAATATGATTTCTGATACTTTTGTTTTATCTGTGAGC
TCTTCCTGAGAAAATCAGTTTTATTTAAAGAGAGAGTTCA
CCCAAAAATAAAAGTTCTGTTACCATTTACTCACTTTTTC
AGGCCTGTTTGAGATTCTGACTTTTACTGAGAGCAAGAGA
GATTTTGAAACCCTGAAATTAAAATTGACTTTCATTGGTA
GTGACTTCAACAGCAACCAGTTTCTAACATTTTTCAAAAT
CTCTTCTTGTGTATTCAATCAAGAAAAGACACTTATAAAG
GTCTGGAACAACTTGATGGGCAGTAAATTCCCTTTTTGGG
TGAACTGTCCCTTTAATGCAAATTTTCTGTTCAGTTTTGT
TAGATAACAATCAACAAGAGAAATATTGTGTATTATAAAA
GACATTTACCATACCATAGCTATTCTGTGTGTTCATATGT
GTACTGAAAGTACTGATGTTTGATCATTTGAAGTGGTACA
ACAACATTCAAGCAACATTTTATTACCCTCATTAGTGTTT
GTAACTGCATACCTAATACGGTGCTAATTACTGCTTTATG
GTGGCATCTTAAGAGGAATATCAAGTCACATTTTAACCCA
GCACTTAACAGTTGGCCCCGTGAAAATACATTTTCACAAA
ATGGTCAGTCTCAATAACAAGATTCTGAAACATTTACTAG
CATTCTAATATGATTAAACTCACACTTATGTAATAAATCT
CTATCAATTTAATATCTTTCGACTGCTGAAGTGTTAATTT
TTTAATTTGTAGTATTTAAACTTTGTCTCAGTTATTCCAA
ACAGACTTCCCTACAAAGGACACACTATTGCAAATAAACA
TAAATCAGCCATGTTGATCAATCACAGCAATGTGGAATCA
TATATAACACAGTATCTATCGGAAAAAACAGTGGTTTGGG
AGGTTTTGTCCTGAAAGCAGTACATTTGCACATCCTTAAA
CTGTTCTGTGTGAGTGTGGTCGTATGAGAACAAACAGTTT
TTGATGGGAGAAGTGATTCATCTTGACTCGTCGTCTCTAC
AGCTTTGGGGTGTCATTAGGGGCCAGTGGGGCACGTCCTC
TTTGGTATCGAGGTGGAAAACGTCCTGGAGGATCGTCCTC
TGTTAGATTTATGGAAAAGGTGACAAATTAAAATATAATT
GAGAACACTGAAACAAACAACATAAACCTAATTACATGTT
TCAAAACTAGTAGTTTTGGCATTGTTTTCGGTGGTGCAGG
CTGTATTTCTGGATATGATTCATGAATCTCATTCCTTTGG
AAACTGGCATGTGAAGGTCATATCTCAAATGACAGCAGCG
CCCTGCTTCTCTCACAGCTGTCCCACTATTCAGTGCTCTG
CAAAGCACAATCTGGCCCTAGCTGCAAAAGCCAAGCATTT
GGAGAGGGGGGAGCACTGGATAAACAGACCTGGCATGTTT
GGATCTCTGGATGTCCCAAAACACTTTGTTTATCATTCAG
CCTCTGGCACAACATGTATTTGTCAATAAATAAAACCAGC
ATTGAAACAT

pla1a TRANSCRIPTS
Type Name Length (nt) Analysis
ncRNA pla1a-002 3370
pseudogenic transcript pla1a-202 (1)    Ensembl 1371
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pla1a-002 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025589 (1),  Ensembl_Trans:ENSDART00000168177 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC066406 (1) 3392 bp
GenBank:EB950138 (1) 639 bp
CITATIONS (2)