Transcript

gnl3-002

ID
ZDB-TSCRIPT-090929-8135
Name
gnl3-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025391 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025391|OTTDARG00000020335|ZDB-GENE-030131-616 gnl3|no_translation gnl3-002 LG_ CR450797.9 Danio rerio protein_coding KNOWN, 773 bp
CAACAGAAGAGGCAGCAGCGAGGAACTAACGCAGTTCTGG
ATCACAGCCGAGCAGCTTCCTGTTTTGGAAAAGACTTTCT
CCTACAGACACTTAATGACTTGGCGAACAAGAAAGAGGGC
GAAACCATGCTAAAAGTTGGCGTCGTCGGTTTTCCTAACG
TTGGAAAGAGCAGCATCATCAACAGTTTGAAAGAAATGCG
AGCGTGCAATGCTGGCGTACAGAGAGGATTGACTAGGTGT
ATGCAGGAAGTGCATATTACCAAGAAAGTGAAGATGATTG
ACAGTCCCGGGATTTTGGCGGCCCTCAGTAACCCTGGAAG
TGCGATGGCCCTCAGGAGCCTGCAGGTGGAGGAGAAAGAG
GAGAGTCCGCAGGAAGCCGTCAGGAATCTACTCAAACAGT
GCAATCAGCAGCATATAATGCTACAGTATAATGTCCCAGA
CTACAGAAGCTCCTTAGAGTTTTTGACCACCTTTGCCATG
AAGCACGGGCTCCTGCAGAAAGGTGGCGTTGCAGACACTG
AACTGGCAGCCACAACATTCCTCAACGACTGGACAGGGGC
TAAGCTGAGTTACTACAGCAGAGTTCCAGAGCGACAGGGT
CTTCCCTCTTACCTGTCCGACGCCATCGTGACTGAACTGC
AGTCAGATGTGGATATGGATGCTGTGAAGAAGGGGAACGA
GAATGTAAAGAGAAGTACACCTTACTAGTACCAAGTTGGA
CACCCTATTGCCTTCAGAATTGAACAGATTCAACGGTACT
GGAAATATTCCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations