Transcript

rps15-201

ID
ZDB-TSCRIPT-090929-8111
Name
rps15-201
Previous Names
  • rps15-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025363 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025363|OTTDARG00000020312|ZDB-GENE-030131-9092 rps15|OTTDARP00000020865 rps15-001 LG_ BX255969.8 Danio rerio protein_coding KNOWN, 497 bp
CTTTTCCGGTAGTCTCTGAAGATGGCGGACACTGAGCAGA
AGAAGAAGCGTACCTTCAGGAAATTCACCTACAGAGGTGT
GGACCTGGACCAGCTGCTGGACATGTCCTATGAGCAGCTG
ATGCAGCTGTATAGCGCCAGGCAGAGGAGGAGGCTGAACC
GCGGCCTCAGGAGGAAGCAGCAGTCTCTCCTTAAACGCCT
CCGCAAGGCCAAGAAGGAGGCGCCACCCATGGAGAAGCCA
GAGGTGGTCAAAACTCACCTGAGAGACATGGTCATCCTGC
CCGAGATGGTGGGCTCCATGGTCGGCGTGTACAACGGCAA
GACCTTCAACCAGGTGGAAATCAAGCCTGAAATGATTGGT
CATTACCTGGGAGAGTTCTCCATCACTTACAAGCCTGTTA
AGCACGGTCGTCCTGGTATTGGAGCCACTCATTCTTCCCG
CTTCATTCCTCTGAAGTAAAAAGTCGATGAGTATGTAAAT
AAAAGCCTCCAGAAGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations